ID: 907443082

View in Genome Browser
Species Human (GRCh38)
Location 1:54490363-54490385
Sequence GCTACCAACTATTCTAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907443082_907443089 17 Left 907443082 1:54490363-54490385 CCATTTCTAGAATAGTTGGTAGC No data
Right 907443089 1:54490403-54490425 GTCTGGCAACTCCCAATGGGTGG No data
907443082_907443088 14 Left 907443082 1:54490363-54490385 CCATTTCTAGAATAGTTGGTAGC No data
Right 907443088 1:54490400-54490422 GGCGTCTGGCAACTCCCAATGGG No data
907443082_907443085 -7 Left 907443082 1:54490363-54490385 CCATTTCTAGAATAGTTGGTAGC No data
Right 907443085 1:54490379-54490401 TGGTAGCAAGAGGATGGAGAAGG No data
907443082_907443087 13 Left 907443082 1:54490363-54490385 CCATTTCTAGAATAGTTGGTAGC No data
Right 907443087 1:54490399-54490421 AGGCGTCTGGCAACTCCCAATGG No data
907443082_907443086 0 Left 907443082 1:54490363-54490385 CCATTTCTAGAATAGTTGGTAGC No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data
907443082_907443092 30 Left 907443082 1:54490363-54490385 CCATTTCTAGAATAGTTGGTAGC No data
Right 907443092 1:54490416-54490438 CAATGGGTGGTGACACAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907443082 Original CRISPR GCTACCAACTATTCTAGAAA TGG (reversed) Intergenic
No off target data available for this crispr