ID: 907443086

View in Genome Browser
Species Human (GRCh38)
Location 1:54490386-54490408
Sequence AAGAGGATGGAGAAGGCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907443080_907443086 2 Left 907443080 1:54490361-54490383 CCCCATTTCTAGAATAGTTGGTA No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data
907443081_907443086 1 Left 907443081 1:54490362-54490384 CCCATTTCTAGAATAGTTGGTAG No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data
907443078_907443086 11 Left 907443078 1:54490352-54490374 CCTCAGTTTCCCCATTTCTAGAA No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data
907443077_907443086 16 Left 907443077 1:54490347-54490369 CCGGGCCTCAGTTTCCCCATTTC No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data
907443082_907443086 0 Left 907443082 1:54490363-54490385 CCATTTCTAGAATAGTTGGTAGC No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data
907443076_907443086 22 Left 907443076 1:54490341-54490363 CCATCTCCGGGCCTCAGTTTCCC 0: 6
1: 127
2: 502
3: 1281
4: 2785
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907443086 Original CRISPR AAGAGGATGGAGAAGGCGTC TGG Intergenic
No off target data available for this crispr