ID: 907444604

View in Genome Browser
Species Human (GRCh38)
Location 1:54499682-54499704
Sequence GGGCGTCTGCGGGAGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907444593_907444604 2 Left 907444593 1:54499657-54499679 CCAGGAGGGAGCAGGGTCGGCGG No data
Right 907444604 1:54499682-54499704 GGGCGTCTGCGGGAGGCTGGGGG No data
907444589_907444604 11 Left 907444589 1:54499648-54499670 CCGGCTGCTCCAGGAGGGAGCAG No data
Right 907444604 1:54499682-54499704 GGGCGTCTGCGGGAGGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907444604 Original CRISPR GGGCGTCTGCGGGAGGCTGG GGG Intergenic
No off target data available for this crispr