ID: 907444639

View in Genome Browser
Species Human (GRCh38)
Location 1:54499812-54499834
Sequence TAAGTGTGGGGTTCGCTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907444639_907444656 28 Left 907444639 1:54499812-54499834 CCTAGGAGCGAACCCCACACTTA No data
Right 907444656 1:54499863-54499885 CAACCTCAGGGGGCCTGAGAGGG No data
907444639_907444650 16 Left 907444639 1:54499812-54499834 CCTAGGAGCGAACCCCACACTTA No data
Right 907444650 1:54499851-54499873 CCAGCTTCCTACCAACCTCAGGG No data
907444639_907444651 17 Left 907444639 1:54499812-54499834 CCTAGGAGCGAACCCCACACTTA No data
Right 907444651 1:54499852-54499874 CAGCTTCCTACCAACCTCAGGGG No data
907444639_907444648 15 Left 907444639 1:54499812-54499834 CCTAGGAGCGAACCCCACACTTA No data
Right 907444648 1:54499850-54499872 GCCAGCTTCCTACCAACCTCAGG No data
907444639_907444652 18 Left 907444639 1:54499812-54499834 CCTAGGAGCGAACCCCACACTTA No data
Right 907444652 1:54499853-54499875 AGCTTCCTACCAACCTCAGGGGG No data
907444639_907444655 27 Left 907444639 1:54499812-54499834 CCTAGGAGCGAACCCCACACTTA No data
Right 907444655 1:54499862-54499884 CCAACCTCAGGGGGCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907444639 Original CRISPR TAAGTGTGGGGTTCGCTCCT AGG (reversed) Intergenic
No off target data available for this crispr