ID: 907446681

View in Genome Browser
Species Human (GRCh38)
Location 1:54512604-54512626
Sequence GTTTCTCCCCCAGCTTCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907446681_907446692 28 Left 907446681 1:54512604-54512626 CCCTATGAAGCTGGGGGAGAAAC No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data
907446681_907446693 29 Left 907446681 1:54512604-54512626 CCCTATGAAGCTGGGGGAGAAAC No data
Right 907446693 1:54512656-54512678 GCACGGTCCTCTCCAATGTTGGG No data
907446681_907446686 7 Left 907446681 1:54512604-54512626 CCCTATGAAGCTGGGGGAGAAAC No data
Right 907446686 1:54512634-54512656 TCAATCAGCCTGGACCCCTTTGG No data
907446681_907446687 12 Left 907446681 1:54512604-54512626 CCCTATGAAGCTGGGGGAGAAAC No data
Right 907446687 1:54512639-54512661 CAGCCTGGACCCCTTTGGCACGG No data
907446681_907446683 -3 Left 907446681 1:54512604-54512626 CCCTATGAAGCTGGGGGAGAAAC No data
Right 907446683 1:54512624-54512646 AACCCAGTACTCAATCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907446681 Original CRISPR GTTTCTCCCCCAGCTTCATA GGG (reversed) Intergenic