ID: 907446682

View in Genome Browser
Species Human (GRCh38)
Location 1:54512605-54512627
Sequence GGTTTCTCCCCCAGCTTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907446682_907446693 28 Left 907446682 1:54512605-54512627 CCTATGAAGCTGGGGGAGAAACC No data
Right 907446693 1:54512656-54512678 GCACGGTCCTCTCCAATGTTGGG No data
907446682_907446683 -4 Left 907446682 1:54512605-54512627 CCTATGAAGCTGGGGGAGAAACC No data
Right 907446683 1:54512624-54512646 AACCCAGTACTCAATCAGCCTGG No data
907446682_907446692 27 Left 907446682 1:54512605-54512627 CCTATGAAGCTGGGGGAGAAACC No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data
907446682_907446686 6 Left 907446682 1:54512605-54512627 CCTATGAAGCTGGGGGAGAAACC No data
Right 907446686 1:54512634-54512656 TCAATCAGCCTGGACCCCTTTGG No data
907446682_907446687 11 Left 907446682 1:54512605-54512627 CCTATGAAGCTGGGGGAGAAACC No data
Right 907446687 1:54512639-54512661 CAGCCTGGACCCCTTTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907446682 Original CRISPR GGTTTCTCCCCCAGCTTCAT AGG (reversed) Intergenic