ID: 907446684

View in Genome Browser
Species Human (GRCh38)
Location 1:54512626-54512648
Sequence GTCCAGGCTGATTGAGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907446684_907446692 6 Left 907446684 1:54512626-54512648 CCCAGTACTCAATCAGCCTGGAC No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data
907446684_907446693 7 Left 907446684 1:54512626-54512648 CCCAGTACTCAATCAGCCTGGAC No data
Right 907446693 1:54512656-54512678 GCACGGTCCTCTCCAATGTTGGG No data
907446684_907446696 21 Left 907446684 1:54512626-54512648 CCCAGTACTCAATCAGCCTGGAC No data
Right 907446696 1:54512670-54512692 AATGTTGGGTTCATGTAAGACGG No data
907446684_907446687 -10 Left 907446684 1:54512626-54512648 CCCAGTACTCAATCAGCCTGGAC No data
Right 907446687 1:54512639-54512661 CAGCCTGGACCCCTTTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907446684 Original CRISPR GTCCAGGCTGATTGAGTACT GGG (reversed) Intergenic