ID: 907446688

View in Genome Browser
Species Human (GRCh38)
Location 1:54512642-54512664
Sequence GGACCGTGCCAAAGGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907446688_907446693 -9 Left 907446688 1:54512642-54512664 CCTGGACCCCTTTGGCACGGTCC No data
Right 907446693 1:54512656-54512678 GCACGGTCCTCTCCAATGTTGGG No data
907446688_907446692 -10 Left 907446688 1:54512642-54512664 CCTGGACCCCTTTGGCACGGTCC No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data
907446688_907446697 24 Left 907446688 1:54512642-54512664 CCTGGACCCCTTTGGCACGGTCC No data
Right 907446697 1:54512689-54512711 ACGGTTCTGTAAAGTTTCCTAGG No data
907446688_907446698 25 Left 907446688 1:54512642-54512664 CCTGGACCCCTTTGGCACGGTCC No data
Right 907446698 1:54512690-54512712 CGGTTCTGTAAAGTTTCCTAGGG No data
907446688_907446696 5 Left 907446688 1:54512642-54512664 CCTGGACCCCTTTGGCACGGTCC No data
Right 907446696 1:54512670-54512692 AATGTTGGGTTCATGTAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907446688 Original CRISPR GGACCGTGCCAAAGGGGTCC AGG (reversed) Intergenic