ID: 907446692

View in Genome Browser
Species Human (GRCh38)
Location 1:54512655-54512677
Sequence GGCACGGTCCTCTCCAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907446684_907446692 6 Left 907446684 1:54512626-54512648 CCCAGTACTCAATCAGCCTGGAC No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data
907446688_907446692 -10 Left 907446688 1:54512642-54512664 CCTGGACCCCTTTGGCACGGTCC No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data
907446681_907446692 28 Left 907446681 1:54512604-54512626 CCCTATGAAGCTGGGGGAGAAAC No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data
907446680_907446692 29 Left 907446680 1:54512603-54512625 CCCCTATGAAGCTGGGGGAGAAA No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data
907446682_907446692 27 Left 907446682 1:54512605-54512627 CCTATGAAGCTGGGGGAGAAACC No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data
907446685_907446692 5 Left 907446685 1:54512627-54512649 CCAGTACTCAATCAGCCTGGACC No data
Right 907446692 1:54512655-54512677 GGCACGGTCCTCTCCAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907446692 Original CRISPR GGCACGGTCCTCTCCAATGT TGG Intergenic