ID: 907451359

View in Genome Browser
Species Human (GRCh38)
Location 1:54547820-54547842
Sequence CCTTCCAGCCTGACCCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907451354_907451359 -7 Left 907451354 1:54547804-54547826 CCTTGGCCTCCTGCCACCTTCCA No data
Right 907451359 1:54547820-54547842 CCTTCCAGCCTGACCCCTTGTGG 0: 1
1: 0
2: 1
3: 25
4: 232
907451352_907451359 13 Left 907451352 1:54547784-54547806 CCGGGAGGTTGCTGGCAGCTCCT No data
Right 907451359 1:54547820-54547842 CCTTCCAGCCTGACCCCTTGTGG 0: 1
1: 0
2: 1
3: 25
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907451359 Original CRISPR CCTTCCAGCCTGACCCCTTG TGG Intronic
900476515 1:2878788-2878810 GCTTCCTCCCTGTCCCCTTGGGG - Intergenic
901054258 1:6441283-6441305 TTCTCCAGCCTTACCCCTTGGGG - Intronic
901678196 1:10898820-10898842 CCTTCCACCCTGGCCTCTGGGGG - Intergenic
902480053 1:16707048-16707070 TTCTCCAGCCTTACCCCTTGGGG + Intergenic
903367977 1:22816576-22816598 CCTCCCACCTGGACCCCTTGCGG + Intronic
904601146 1:31673180-31673202 CTTTCCAGCCTCACTCCTCGTGG - Intronic
905002231 1:34681653-34681675 CCTTCAAGCCTGACACCCAGTGG + Intergenic
905172890 1:36119490-36119512 CCCTCCTGCCTGACCCCCAGGGG + Intronic
907451359 1:54547820-54547842 CCTTCCAGCCTGACCCCTTGTGG + Intronic
911065572 1:93785010-93785032 CCTTCCAGGCTGGCCCTTTTGGG - Intronic
915468094 1:156109438-156109460 CTTTCCAGCCTTACCTCTAGTGG + Intronic
915706138 1:157845658-157845680 CCTGTCAGCCTGGGCCCTTGTGG + Intronic
915929994 1:160054370-160054392 CCTCCCAGCCTGGCCCCATCTGG + Intronic
916509621 1:165460509-165460531 CCTATCAGCCTGACCCCTTGGGG - Intergenic
917084457 1:171291994-171292016 CCTTCCGGCTGGACCCTTTGAGG - Intergenic
924042268 1:239995475-239995497 ACTTCCAGCCTGACCTCCTGTGG - Intergenic
1062981536 10:1726837-1726859 GCTTCCAGCGTGAGCCCCTGAGG - Intronic
1064361705 10:14671509-14671531 CCAACCAGCCTGCCCACTTGGGG - Intronic
1066319627 10:34288868-34288890 CCTTTCAGCCTGACACCTGCTGG - Intronic
1067497442 10:46773508-46773530 CCCTCCTGCCTGACCCCCGGAGG + Intergenic
1067597210 10:47566907-47566929 CCCTCCTGCCTGACCCCCGGAGG - Intergenic
1067786417 10:49252733-49252755 CCCTCCACCCTGAGCCCTGGCGG + Intergenic
1070032799 10:72692827-72692849 CCTTCCTGCCCGACCCCTCGGGG - Intronic
1070760330 10:79020284-79020306 CCATCCAGCCTGAACTCCTGTGG - Intergenic
1072199278 10:93144191-93144213 CCTTCCAGTCTGGCCCCCTTTGG - Intergenic
1074532483 10:114306546-114306568 CCTTCCTGCCTGGCCCAGTGGGG + Intronic
1075762852 10:124870002-124870024 CCTTCCTGCCTGAAGCATTGGGG + Intergenic
1076846652 10:133072479-133072501 CCCTCCAGCCGGACCTCCTGTGG - Intronic
1078128098 11:8587755-8587777 GATTCCCGCTTGACCCCTTGGGG - Intronic
1081665850 11:44916709-44916731 CCTTCCAGCCTGGCACATCGGGG + Intronic
1083297308 11:61721960-61721982 CTTTCCAGGCTGCCCCCATGAGG + Intronic
1083882621 11:65555920-65555942 CCATCCTGCCTGGCCTCTTGGGG + Intronic
1085298152 11:75442567-75442589 CCTGCCAGACTGACCCCTTCTGG - Exonic
1087196126 11:95305841-95305863 CCTTCCAGACTGGGCCTTTGGGG - Intergenic
1088495084 11:110424363-110424385 CCTTCCGGCCAGACCTTTTGAGG + Intergenic
1089670956 11:120056689-120056711 TCTTCCAGCCTGAGCCTGTGAGG + Intergenic
1090409097 11:126495396-126495418 CCTCCCTGCCTGACCCCAGGTGG + Intronic
1091873212 12:3912287-3912309 CCTGCCAGCCTGCCCTCGTGGGG + Intergenic
1092776622 12:11949588-11949610 TCTTCCATCCTGAGACCTTGTGG - Intergenic
1092929271 12:13299966-13299988 CCTTTCAGACTAAGCCCTTGGGG + Intergenic
1097040779 12:56154694-56154716 GCTTCCAGCCTGGTCCCTTTGGG + Intronic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1101806703 12:108070228-108070250 CCTCCCAGCCTGTCCACATGGGG - Intergenic
1103857412 12:123982489-123982511 CCTTCCAGAGTGACCACCTGGGG - Intronic
1105673644 13:22646604-22646626 CTTTCCAGTCTGTTCCCTTGAGG + Intergenic
1107738848 13:43427498-43427520 CCTTCTAGTCTGACTCTTTGTGG - Intronic
1113755390 13:112807890-112807912 CTTTCCAGCCTGGCCCCAGGAGG + Intronic
1115635028 14:35282874-35282896 CACTCCAGCCTGACCCTGTGGGG - Intronic
1116589650 14:46755336-46755358 CCCTCCAGCCTGCCCCTTGGAGG - Intergenic
1117094548 14:52283891-52283913 CCTTCCAGCTGGACCTTTTGAGG + Intergenic
1120214821 14:81669936-81669958 CCTCCCACCCTGCCCTCTTGTGG + Intergenic
1121170232 14:91847665-91847687 CTTCCCCACCTGACCCCTTGTGG + Intronic
1121467581 14:94126031-94126053 CCTTCATACCTGAGCCCTTGGGG + Intergenic
1122123661 14:99567870-99567892 CTTTCCAGCTTGCCACCTTGGGG + Intronic
1202830070 14_GL000009v2_random:18606-18628 CCTTCATGCCTGACTCCTTTTGG + Intergenic
1124689036 15:31806528-31806550 CCTTCCATGCAGACCCCTCGTGG + Intronic
1127801183 15:62478635-62478657 CCTCCCAGCCTGAGCCCTCGAGG - Intronic
1128158956 15:65410625-65410647 CGCTCCAGCCTTACCCCTTAGGG - Intronic
1129653954 15:77510540-77510562 GTTTCCAGCCTGACCTCCTGGGG + Intergenic
1129878846 15:78994201-78994223 TCCTCCAGACTGACCCTTTGGGG - Intronic
1130050678 15:80481075-80481097 CTTTCCAGCCAGATCCCTTGGGG - Intronic
1130885534 15:88089747-88089769 GCTTCCACCCTGGCCCCCTGTGG + Intronic
1132216031 15:100062277-100062299 CCATCCACCCTGCCTCCTTGAGG - Intronic
1132695666 16:1200710-1200732 CCTTCCAGCGTGATCACCTGGGG - Exonic
1132730168 16:1357129-1357151 CCTCCCAGCCTGACCGCTGGGGG - Intronic
1133753239 16:8741108-8741130 CCATCCAGCCTGGCCCTCTGGGG - Intronic
1134561048 16:15209907-15209929 CCTTTCAGCATGAACCCTTCAGG - Intergenic
1134819370 16:17233810-17233832 ACATCCTGCCTGGCCCCTTGGGG + Intronic
1134921585 16:18121531-18121553 CCTTTCAGCATGAACCCTTCAGG - Intergenic
1136990730 16:35149918-35149940 CCTTCCAGCCTTTGGCCTTGTGG + Intergenic
1137369040 16:47887528-47887550 CTTTCCAGCCTGACCTCTTCTGG - Intergenic
1137782636 16:51110650-51110672 CCTTCCTTTCTGACCCCTTGTGG + Intergenic
1137876166 16:51998585-51998607 CCTTCCTGCCTGCCCTCCTGAGG + Intergenic
1139583529 16:67886674-67886696 CCTTCTATCCTGGCCCCTGGGGG + Intronic
1139655284 16:68383660-68383682 CCTTCTCGGCTGATCCCTTGTGG + Intronic
1140968186 16:79987667-79987689 CCTTCCAGTCTCTCCTCTTGCGG + Intergenic
1141685911 16:85569918-85569940 ACTTCCTGCCTGAGCCCTAGGGG + Intergenic
1142022850 16:87794948-87794970 CTTCCCAGCCTGAACCCTTTGGG + Intergenic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1143116222 17:4583285-4583307 CGTTCCTTCCTGTCCCCTTGGGG + Intergenic
1143514623 17:7413617-7413639 CCTTCCCGCCATACCCCCTGAGG - Intronic
1144718798 17:17453328-17453350 CCATCCAGCCTGACCCAGTTAGG - Intergenic
1146169461 17:30621600-30621622 ACCTCCATCCTGACCCCATGGGG - Intergenic
1146170101 17:30625849-30625871 ACCTCCATCCTGACCCCATGGGG + Intergenic
1146933312 17:36793370-36793392 CCTTCCAGCCTGGGCCAGTGTGG - Intergenic
1146992724 17:37289797-37289819 CCTTCCAACTTCACCCCTTAAGG + Intronic
1147446553 17:40478453-40478475 TCTGTCACCCTGACCCCTTGAGG + Intronic
1147553072 17:41458577-41458599 CCAGCCAGCAAGACCCCTTGAGG + Intergenic
1147914206 17:43877056-43877078 CCTGCCAGCCTGGCCCTGTGGGG + Intronic
1148122571 17:45221718-45221740 CCCTCCAGCCCGCCCCCCTGGGG + Intronic
1151294101 17:73171106-73171128 CCTTCTAGCCTCTGCCCTTGGGG + Intergenic
1151772559 17:76173874-76173896 CCTTCCTGCCTCACCTCTTAGGG - Intronic
1151858281 17:76737994-76738016 CCTCCCAGCCTGACTCACTGCGG - Exonic
1153340881 18:3973564-3973586 CCTTCCAGCATGTTCCCTAGGGG - Intronic
1158638250 18:59180031-59180053 CCTTCCAGCCTTTCCTCTGGAGG + Intergenic
1160124919 18:76163089-76163111 CCTTCCATCCTCTCCACTTGCGG + Intergenic
1160603090 18:80029339-80029361 CCTTCCAGCTGGACCTTTTGAGG + Intronic
1161295974 19:3520323-3520345 CCTTCCAGCCTGCCCCCTACTGG - Intronic
1161558360 19:4957087-4957109 CCTTCTTTCCTGACCCCTAGGGG - Intronic
1161982069 19:7635148-7635170 CTTCTCAGCCTGACCCCTTGGGG - Intronic
1162025293 19:7890298-7890320 CTTTCCAGCCTGAGACCATGTGG - Intronic
1163660164 19:18572107-18572129 CCTGCCAGCGTGACCCCACGAGG + Intronic
1164715484 19:30387726-30387748 CCTTCCAGCCAGGTCCCCTGGGG - Intronic
1165120168 19:33553747-33553769 CCTTCCAGCCTGAGCTATTTGGG - Intergenic
1165127763 19:33612899-33612921 TCTTCCAGCCTTCCTCCTTGAGG + Intergenic
1165148719 19:33748937-33748959 CTTCCCAGCCTCACTCCTTGAGG - Intronic
1166406597 19:42526290-42526312 CCTCTCAGCCTGATCCCTGGTGG + Intronic
1168117841 19:54234152-54234174 CCCTCCAGCCTGGCCCCTGGAGG - Intronic
1202714090 1_KI270714v1_random:32954-32976 TTCTCCAGCCTTACCCCTTGGGG + Intergenic
925167091 2:1722822-1722844 CCTCACAGCCTGACCCCTTCTGG + Intronic
927199663 2:20570549-20570571 CCCACCATCCTGAGCCCTTGGGG - Intronic
927500123 2:23577055-23577077 CCTTCCATCCTGGGGCCTTGAGG - Intronic
928427433 2:31190868-31190890 CCTTCCTACCTGACCCCTCCTGG + Intronic
930942345 2:57028060-57028082 CATTCCAGCCCTACCCTTTGTGG - Intergenic
932491157 2:72121970-72121992 TCTTCCAGGCTGGCCACTTGTGG - Intergenic
937236177 2:120433075-120433097 CCTTCCAGGCTGGCCCCATCAGG - Intergenic
938409875 2:131055084-131055106 CCTACCTGAGTGACCCCTTGTGG - Intronic
939105615 2:137945251-137945273 CCTCCCACCCTGCCCCCTTGGGG - Intergenic
942315892 2:174696305-174696327 CCTCACAGCCTTACACCTTGGGG + Intergenic
944210482 2:197201824-197201846 CCTCCCATCCTGCCCCCTTTTGG + Intronic
945988358 2:216372198-216372220 CCTTCCAGCACCACCCCTTTGGG - Intergenic
947915898 2:233831336-233831358 CCTGCCAGCCTCACCCCTCTGGG + Intronic
948514996 2:238498239-238498261 CCCTCCCGCGTGGCCCCTTGAGG - Intergenic
948523736 2:238558060-238558082 CCTTCCAGCCTGACCTCCTTGGG - Intergenic
948674575 2:239589356-239589378 CCTGACCGCCTGAGCCCTTGGGG + Intergenic
1169324406 20:4663599-4663621 CCTTCCACCCTCCCACCTTGTGG + Intergenic
1170072178 20:12381070-12381092 CCTTCAAGCCTGACCTCTACAGG + Intergenic
1174278761 20:49422967-49422989 CCTGCCATCCTGGCCCCTTGGGG - Intronic
1174539194 20:51275801-51275823 CCTTCCAGAATGACCCATGGAGG + Intergenic
1175162293 20:57017882-57017904 CCTTCCCTCCTGATCCCTGGTGG + Intergenic
1176154645 20:63612462-63612484 CCTTCCCAGCTCACCCCTTGTGG - Intronic
1176194941 20:63832412-63832434 CCGTCCAGCCTGCCTCCCTGCGG + Intergenic
1176425147 21:6544118-6544140 CCTACCATGCTGGCCCCTTGGGG - Intergenic
1176609256 21:8863446-8863468 CCTTCATGCCTGACTCCTTTTGG + Intergenic
1176679467 21:9811620-9811642 CCTGCCGGCCTGACCACATGTGG - Intergenic
1176680037 21:9814437-9814459 CCTGCCGGCCTGACCACGTGTGG - Intergenic
1176680320 21:9815846-9815868 CCTGCCGGCCTGACCACATGTGG - Intergenic
1176680604 21:9817255-9817277 CCTGCCGGCCTGACCACATGTGG - Intergenic
1176680890 21:9818660-9818682 CCTGCCGGCCTGACCACGTGTGG - Intergenic
1176681172 21:9820067-9820089 CCTGCCGGCCTGACCACATGTGG - Intergenic
1176681745 21:9822895-9822917 CCTGCCGGCCTGACCACATGTGG - Intergenic
1177215034 21:18117010-18117032 CCTTGCTGGCTGACCCCTTCTGG - Intronic
1179047513 21:37859982-37860004 CCTTGCATCATGACTCCTTGTGG + Intronic
1179599490 21:42466613-42466635 TTTTCCAGACTGACCCTTTGGGG + Intergenic
1179700638 21:43152435-43152457 CCTACCATGCTGGCCCCTTGGGG - Intergenic
1180920037 22:19516921-19516943 CTTTCCCACCTGACCCTTTGAGG + Intronic
1181079593 22:20405245-20405267 CCTTCCAGCCTTGGCCCTGGTGG + Intronic
1181636407 22:24176782-24176804 CCAACCAGCCAGACCCCTTGGGG + Intronic
1181967220 22:26665649-26665671 CCTACCAGCCTGCCCTCTTCTGG + Intergenic
1182072749 22:27475137-27475159 CCTTCCAGCCTGAAGCCCTGAGG - Intergenic
1182129520 22:27840665-27840687 CCTTCCACCCTGACCCTGTCCGG - Intergenic
1182743079 22:32583002-32583024 TCTTCCAGCTTCACCCCTGGAGG + Intronic
1185318636 22:50190175-50190197 CCTTCCCGCCTGGCTCCCTGCGG + Intronic
949932243 3:9088206-9088228 CCTGCCACCCTGACCCCTGCAGG - Intronic
953231065 3:41065469-41065491 CCTTCCAGACTGGCCCCTTCTGG - Intergenic
954799185 3:53177359-53177381 CCTTCTAAATTGACCCCTTGGGG - Intronic
956736053 3:72239106-72239128 CTCTCCAGCCTGGCCCCTTAGGG - Intergenic
960003404 3:112756326-112756348 CCTCCCACCAGGACCCCTTGCGG - Intronic
960171640 3:114468819-114468841 TCTTCCACCCTGGCTCCTTGAGG - Intronic
960927375 3:122808476-122808498 TCTTCCACCCTGAACTCTTGCGG - Intronic
961794774 3:129401662-129401684 CCTACCACCCTGACCACTGGTGG - Exonic
962527094 3:136246638-136246660 CCATCCATCCTCACTCCTTGTGG + Intergenic
964988240 3:162771833-162771855 CCTTCCAGCTGGACCTTTTGAGG + Intergenic
965617082 3:170604949-170604971 CCTTACAGCCTGAGCCCTCATGG - Intronic
968434697 4:578444-578466 CCTTCCACCCTCACCCTTTAGGG - Intergenic
968946768 4:3669033-3669055 CTTTCCTGCCTGACCCCTGGCGG + Intergenic
969721849 4:8896403-8896425 CCCTCCAGCCTGACCTCAGGAGG + Intergenic
970609493 4:17711775-17711797 CCTTCCATCCTATCCCCATGAGG - Intronic
971200808 4:24507813-24507835 CCTTCCAGCCTGCCCACTGCTGG + Intergenic
976223968 4:82780815-82780837 CCGTCCAGGCTGGCCCCCTGGGG - Intronic
984600684 4:181722923-181722945 CCATCTAGCCTGGCCCATTGTGG - Intergenic
984666155 4:182431673-182431695 CCTGCCACCCTGACCCCTGCAGG - Intronic
984840123 4:184060387-184060409 CCTTCCAGGCTCAGCCCTGGGGG + Intergenic
988879236 5:35482445-35482467 CCTCCCAGCCTCACTGCTTGTGG + Intergenic
991429536 5:66529897-66529919 CCTACCAGGCTGACAGCTTGAGG + Intergenic
994047453 5:95325916-95325938 CCTTCCACCCTACCCCCTTTTGG + Intergenic
995421537 5:111972845-111972867 CCTGCCAGCTTGAACCCATGTGG + Intronic
996186017 5:120476239-120476261 CCTTCCAGCCTGACATCCAGTGG + Intronic
998071934 5:139204790-139204812 CCTTCCAGCCTGATTTCTTTAGG - Intronic
998401881 5:141852621-141852643 CCTTACACCCTGGCCCCCTGAGG + Intergenic
999670534 5:153955613-153955635 CAGTCCAACCTGACCCCTTCAGG + Intergenic
999678023 5:154026159-154026181 CCTTCCAACCAAACCCTTTGTGG - Intronic
999683526 5:154081931-154081953 CATCCCAGCCTGATCCCATGGGG - Intronic
999690881 5:154144902-154144924 CCACCCAGCCTGACCCATTTGGG + Intronic
1001963685 5:175895484-175895506 CCTTCCAGCCTGTCCGTGTGAGG - Intergenic
1002306842 5:178288529-178288551 CCCTCCAGCCTGGCCCTCTGAGG - Intronic
1002311253 5:178315272-178315294 CCCTCCAACCGGAGCCCTTGGGG - Intronic
1003135330 6:3430722-3430744 CCCTCCAGCCTCATCCCTTCTGG - Intronic
1003651742 6:7967203-7967225 CCTTCAATCCTGATCCCTTTTGG - Intronic
1005989264 6:30893104-30893126 CCTTCCCGCCAGCCCCCTGGTGG + Exonic
1006387392 6:33738955-33738977 GCCTTCAGCCTGATCCCTTGTGG - Intronic
1012142027 6:95636468-95636490 CCTTCAAGCCTGAAGCCTGGGGG - Intergenic
1012404976 6:98885876-98885898 CCTCCCAACTTGATCCCTTGTGG + Intronic
1013420234 6:109960540-109960562 CCTCCTATCCTGACCCCTTGAGG - Intergenic
1017062007 6:150492847-150492869 CCTTCCATCCTCCCTCCTTGTGG + Intergenic
1017622652 6:156315143-156315165 CCTTCCAGCCTCAGTCCTAGGGG - Intergenic
1018568589 6:165183825-165183847 ACTTCCATCCTGACCCCTCCTGG - Intergenic
1018670625 6:166173841-166173863 TCTTCCTGCCTGTTCCCTTGAGG - Intergenic
1020214677 7:6180503-6180525 CCTTCCAGCCTCGCTCCTGGCGG - Intronic
1022840426 7:34158953-34158975 CGTTCCGGTCTGACCCCTTGTGG + Intergenic
1023216503 7:37868654-37868676 CCTTCAAGCCCCAGCCCTTGTGG - Intronic
1023297006 7:38725450-38725472 CCTTCGAGTCTGAGCGCTTGTGG - Exonic
1023549811 7:41357515-41357537 CCAGCTAGCCTGACCCCGTGGGG + Intergenic
1025015537 7:55436106-55436128 CCTTGCAGTGTGACACCTTGTGG + Intronic
1026429124 7:70326263-70326285 ACTTCCAGCCTGTCTCCTAGGGG + Intronic
1027141685 7:75662061-75662083 CCCTCCACCTTCACCCCTTGTGG - Intronic
1027754957 7:82201810-82201832 CCTTTCAGCCTGATCCCATGAGG - Intronic
1030115301 7:106058377-106058399 CCTGCAGGCCTGACCCCCTGAGG - Intergenic
1031619450 7:123918379-123918401 GGTTCCAGCCACACCCCTTGTGG + Intergenic
1032097635 7:128947466-128947488 CCTGCCAGCCTGCCCCCTGCAGG + Exonic
1033653407 7:143358750-143358772 CCCTCCAACCTGATCCCCTGTGG - Intronic
1034115802 7:148582768-148582790 CTTACCAGCCTGAGCCCTAGCGG - Intergenic
1034258362 7:149736930-149736952 CCTTCCATCAGGACCCCTGGGGG - Intergenic
1034556391 7:151852875-151852897 TCTTCCCTCCTGACCCCTTATGG - Intronic
1037145994 8:15573546-15573568 CCTTCCCCCCTCATCCCTTGAGG + Intronic
1038342916 8:26703041-26703063 CCTTTCAGTCTGCTCCCTTGTGG - Intergenic
1039953649 8:42191121-42191143 CCTGACAGCCTGGCTCCTTGGGG + Intronic
1042555218 8:70028716-70028738 ACTTCCCTCCTTACCCCTTGAGG + Intergenic
1046744273 8:117860346-117860368 CCTTCCACCCTCCCACCTTGAGG - Intronic
1049021074 8:139958039-139958061 CAAACCAGCCAGACCCCTTGTGG + Intronic
1049210942 8:141386158-141386180 CCTTCCAGGCTGATCTCTGGGGG + Intergenic
1049774633 8:144398648-144398670 GCTTCCAGCCTGCCCCCCTTTGG - Intronic
1050941918 9:11471428-11471450 CCTGCCACCTTGACCCCTTCCGG + Intergenic
1056845218 9:90031786-90031808 CCTTCCAGCCTGAATGCTTCTGG + Intergenic
1056942154 9:90964953-90964975 CCTGCCAGGAGGACCCCTTGGGG - Intergenic
1056951453 9:91043552-91043574 CCTTCCAGCCATGCCCCTGGTGG + Intergenic
1057032127 9:91783942-91783964 CTTTCCATCCTGACTCCTTGAGG + Intronic
1059764945 9:117375186-117375208 CCCTCCAGACTGAGCCCTAGAGG - Intronic
1060301096 9:122375100-122375122 CCGCCCACCCTGACACCTTGGGG + Intronic
1060588422 9:124801113-124801135 CCTTCTAGCCTGCCCCCCAGGGG + Intronic
1061832115 9:133302890-133302912 CCTCCCAGCCTGATCCCCAGGGG - Intergenic
1061879888 9:133563293-133563315 CCTTCCGGGCAGACCCCTAGCGG + Intronic
1062008528 9:134254459-134254481 CCTACCAGCCTGGCCTCCTGGGG - Intergenic
1062035230 9:134379938-134379960 CCTCCCAGCCTGCTCCCCTGGGG + Intronic
1203664635 Un_KI270754v1:14155-14177 CCTGCCGGCCTGACCACATGTGG - Intergenic
1203666054 Un_KI270754v1:21198-21220 CCTGCCGGCCTGACCACATGTGG - Intergenic
1203666343 Un_KI270754v1:22607-22629 CCTGCCGGCCTGACCACGTGTGG - Intergenic
1203666631 Un_KI270754v1:24014-24036 CCTGCCGGCCTGACCACATGTGG - Intergenic
1203667201 Un_KI270754v1:26837-26859 CCTGCCGGCCTGACCACATGTGG - Intergenic
1203667492 Un_KI270754v1:28246-28268 CCTGCCGGCCTGACCACGTGTGG - Intergenic
1203667780 Un_KI270754v1:29653-29675 CCTGCCGGCCTGACCACATGTGG - Intergenic
1203668349 Un_KI270754v1:32476-32498 CCTGCCGGCCTGACCACATGTGG - Intergenic
1203668640 Un_KI270754v1:33885-33907 CCTGCCGGCCTGACCACGTGTGG - Intergenic
1203668922 Un_KI270754v1:35295-35317 CCTGCCGGCCTGACCACATGTGG - Intergenic
1203669486 Un_KI270754v1:38111-38133 CCTGCCGGCCTGACCACGTGTGG - Intergenic
1186111294 X:6259135-6259157 CCTTCCCTACTGACCCCTTTTGG + Intergenic
1186263327 X:7804611-7804633 CCTTCCAGCCTTTCACCTTGGGG - Intergenic
1186561276 X:10616111-10616133 ACTTCAAGCCTGACCCCTGCAGG + Intronic
1187354442 X:18553725-18553747 CCTTCCAGGCGGATCACTTGAGG - Intronic
1189386796 X:40543757-40543779 CCTCCCAGCATGACCGCCTGTGG - Intergenic
1189967696 X:46391500-46391522 CCATCCAGCCTGACCCTTGCAGG + Intergenic
1190500872 X:51077240-51077262 TCTTCCACCCTCACTCCTTGAGG + Intergenic
1192144215 X:68670336-68670358 CCTTTCAGCCTGACTTCTGGAGG - Intronic
1195045975 X:101054981-101055003 ACTTCCATCCTAAACCCTTGAGG + Intergenic
1196864680 X:120060071-120060093 ACTTCCAGCATGACAGCTTGAGG + Intergenic
1196878421 X:120176260-120176282 ACTTCCAGCATGACAGCTTGAGG - Intergenic
1198039570 X:132836439-132836461 CCTTCCAGCCTTCCCATTTGTGG - Intronic
1200126357 X:153816621-153816643 CCTTCCAACCAAGCCCCTTGGGG - Intronic
1201454183 Y:14150552-14150574 CCTTCCAGACTTTCACCTTGGGG + Intergenic