ID: 907453799

View in Genome Browser
Species Human (GRCh38)
Location 1:54562603-54562625
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907453789_907453799 16 Left 907453789 1:54562564-54562586 CCCGGACGGGGTGGCTGCCGGGC 0: 570
1: 950
2: 2606
3: 3821
4: 9042
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453790_907453799 15 Left 907453790 1:54562565-54562587 CCGGACGGGGTGGCTGCCGGGCG 0: 816
1: 1324
2: 2195
3: 2885
4: 2723
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453782_907453799 26 Left 907453782 1:54562554-54562576 CCACCTCCCTCCCGGACGGGGTG 0: 829
1: 4285
2: 2935
3: 1417
4: 2847
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453786_907453799 19 Left 907453786 1:54562561-54562583 CCTCCCGGACGGGGTGGCTGCCG 0: 544
1: 610
2: 1355
3: 8032
4: 5749
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453785_907453799 20 Left 907453785 1:54562560-54562582 CCCTCCCGGACGGGGTGGCTGCC 0: 580
1: 904
2: 4319
3: 2653
4: 1084
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453779_907453799 28 Left 907453779 1:54562552-54562574 CCCCACCTCCCTCCCGGACGGGG 0: 4484
1: 3502
2: 1232
3: 385
4: 314
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453775_907453799 30 Left 907453775 1:54562550-54562572 CCCCCCACCTCCCTCCCGGACGG 0: 4108
1: 3242
2: 1033
3: 276
4: 427
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453777_907453799 29 Left 907453777 1:54562551-54562573 CCCCCACCTCCCTCCCGGACGGG 0: 4530
1: 3555
2: 1253
3: 275
4: 396
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453793_907453799 -1 Left 907453793 1:54562581-54562603 CCGGGCGGAGAGGCTCCTCACTT 0: 275
1: 2694
2: 8362
3: 5948
4: 4283
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453781_907453799 27 Left 907453781 1:54562553-54562575 CCCACCTCCCTCCCGGACGGGGT 0: 837
1: 4519
2: 2950
3: 966
4: 438
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
907453784_907453799 23 Left 907453784 1:54562557-54562579 CCTCCCTCCCGGACGGGGTGGCT 0: 860
1: 4483
2: 3060
3: 1341
4: 910
Right 907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907453799 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intronic
Too many off-targets to display for this crispr