ID: 907457106

View in Genome Browser
Species Human (GRCh38)
Location 1:54582910-54582932
Sequence GAATTTCTTCCCAATACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907457105_907457106 -6 Left 907457105 1:54582893-54582915 CCTAGGGCTTCTTTCTGGAATTT 0: 1
1: 3
2: 2
3: 30
4: 363
Right 907457106 1:54582910-54582932 GAATTTCTTCCCAATACCCCTGG No data
907457099_907457106 11 Left 907457099 1:54582876-54582898 CCATTTCCTCAGCTCTCCCTAGG No data
Right 907457106 1:54582910-54582932 GAATTTCTTCCCAATACCCCTGG No data
907457098_907457106 12 Left 907457098 1:54582875-54582897 CCCATTTCCTCAGCTCTCCCTAG 0: 1
1: 0
2: 2
3: 24
4: 351
Right 907457106 1:54582910-54582932 GAATTTCTTCCCAATACCCCTGG No data
907457104_907457106 -5 Left 907457104 1:54582892-54582914 CCCTAGGGCTTCTTTCTGGAATT No data
Right 907457106 1:54582910-54582932 GAATTTCTTCCCAATACCCCTGG No data
907457102_907457106 5 Left 907457102 1:54582882-54582904 CCTCAGCTCTCCCTAGGGCTTCT No data
Right 907457106 1:54582910-54582932 GAATTTCTTCCCAATACCCCTGG No data
907457097_907457106 13 Left 907457097 1:54582874-54582896 CCCCATTTCCTCAGCTCTCCCTA 0: 1
1: 1
2: 4
3: 60
4: 502
Right 907457106 1:54582910-54582932 GAATTTCTTCCCAATACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907457106 Original CRISPR GAATTTCTTCCCAATACCCC TGG Intronic
No off target data available for this crispr