ID: 907457725

View in Genome Browser
Species Human (GRCh38)
Location 1:54586103-54586125
Sequence CTGTGCAGTGGGTGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1101
Summary {0: 1, 1: 0, 2: 18, 3: 117, 4: 965}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907457716_907457725 18 Left 907457716 1:54586062-54586084 CCTCTGCAGTGTTTCTGGGGGCT 0: 1
1: 0
2: 1
3: 16
4: 230
Right 907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG 0: 1
1: 0
2: 18
3: 117
4: 965
907457715_907457725 19 Left 907457715 1:54586061-54586083 CCCTCTGCAGTGTTTCTGGGGGC 0: 1
1: 0
2: 0
3: 17
4: 212
Right 907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG 0: 1
1: 0
2: 18
3: 117
4: 965
907457713_907457725 20 Left 907457713 1:54586060-54586082 CCCCTCTGCAGTGTTTCTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 231
Right 907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG 0: 1
1: 0
2: 18
3: 117
4: 965

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907457725 Original CRISPR CTGTGCAGTGGGTGGGTGGG TGG Intronic
900291468 1:1925470-1925492 CAGGGCAGGGGGTGGGTGGTGGG + Intronic
900323522 1:2096241-2096263 TTGTGCAGTGTGTGCCTGGGAGG + Intronic
900401678 1:2475332-2475354 CTGGGCAGTGGGTGGGAAGAAGG + Intronic
900469932 1:2848793-2848815 CTGTGCCCTGGGTGGGAGTGAGG + Intergenic
900469956 1:2848888-2848910 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900470014 1:2849110-2849132 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900470063 1:2849269-2849291 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900470073 1:2849301-2849323 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900470179 1:2849682-2849704 CTGTGCCCTGGGTGGGAGTGTGG + Intergenic
900507536 1:3037202-3037224 CTGTGCTGGGGAGGGGTGGGTGG - Intergenic
900582123 1:3414491-3414513 CTGTGGAGCGGGTGGCTCGGCGG + Intronic
900643229 1:3697188-3697210 CTGAGCAGTGGGTGCGAGGTGGG - Intronic
900649964 1:3725852-3725874 GGATGGAGTGGGTGGGTGGGTGG + Intronic
900650022 1:3726043-3726065 GGATGGAGTGGGTGGGTGGGTGG + Intronic
900787473 1:4657705-4657727 CTGGGCAGGGGGTGGGGGTGGGG + Intronic
900943192 1:5814402-5814424 CTTTGCAGGGGGCGGGTGGCAGG + Intergenic
901007206 1:6177955-6177977 CTGTGCAGTGGGTGGTCAGAAGG + Intronic
901053224 1:6436122-6436144 CTGTGCGGTGGGAGGGAGGGAGG + Intronic
901056594 1:6451286-6451308 CTGGGCAGTCAGTGGCTGGGCGG + Intronic
901379355 1:8862685-8862707 CGCTGCAGTGGGTGGGTAGGGGG + Intronic
901425173 1:9178060-9178082 CAGGGCAGGGGGTGGCTGGGTGG + Intergenic
901628185 1:10635245-10635267 CTGAGCAGCCGGTGGGTGGGTGG - Intergenic
901928828 1:12583935-12583957 CTGATGGGTGGGTGGGTGGGTGG - Intronic
902037034 1:13465343-13465365 CTGAGCTGTGGATGGGTGGGTGG - Intergenic
902361171 1:15943367-15943389 CTGGCCAGTGGGTGTGGGGGAGG + Intronic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902579371 1:17398668-17398690 CACTTCTGTGGGTGGGTGGGTGG - Exonic
902974649 1:20080151-20080173 CAGTGTGGTGGGTGGGAGGGAGG + Intronic
903030947 1:20464028-20464050 CTGTCCATGGAGTGGGTGGGTGG - Intergenic
903248927 1:22038142-22038164 CTGAGCAGTGAGTGGGTGCCAGG + Intergenic
903269506 1:22178616-22178638 CTGTTGGGTGGGTGGGTGGGTGG - Intergenic
903374976 1:22860188-22860210 TTGGAGAGTGGGTGGGTGGGAGG + Intronic
903375281 1:22861987-22862009 TTGTGCAATGGGTAAGTGGGTGG - Intronic
903378979 1:22883970-22883992 CAGTGAGGTGGGTGGGTGGGGGG - Intronic
903441639 1:23392761-23392783 GTGTGGAGTGGGTGTGTGTGTGG - Intronic
903607400 1:24584954-24584976 GTGCCCAGTGAGTGGGTGGGCGG + Intronic
904120201 1:28193229-28193251 GTTTGCAGTGAGTGGGTGGAGGG + Intronic
904121329 1:28199928-28199950 GTGATGAGTGGGTGGGTGGGTGG - Intronic
904175855 1:28628216-28628238 CGGTGCAGGGGGTGGGGGGGGGG + Intronic
904250653 1:29221756-29221778 CTGTGAGTTGGCTGGGTGGGTGG + Intronic
904373277 1:30064392-30064414 CTCTGCAGTGTGTGGGTGGGAGG + Intergenic
904595540 1:31642528-31642550 CTATGTAGTGGGTGGAGGGGAGG + Intronic
904818038 1:33220185-33220207 CTCTGCAGTGGGGGGTTTGGGGG + Intergenic
904834620 1:33327237-33327259 CTGTGCATTGGGTTTGTGGAAGG + Intronic
904842061 1:33379303-33379325 GGGGGCAGTGGGGGGGTGGGGGG - Intronic
905180530 1:36162830-36162852 ATGTCCGATGGGTGGGTGGGTGG - Intronic
905482093 1:38268644-38268666 CGGTGCAGGGGGGTGGTGGGGGG - Intergenic
905789593 1:40783215-40783237 CAGTGCTGTGTGTGGCTGGGTGG - Intergenic
905851166 1:41276131-41276153 CTGTGCACTGGGTGTGTGCTGGG - Intergenic
905876349 1:41434260-41434282 CTGTGCAGTGAGTGGAGGGTGGG - Intergenic
906117511 1:43366417-43366439 CTGTGCAGGGGGTGGAGGGTGGG + Intronic
906253295 1:44328223-44328245 CAGTGCATTGCGGGGGTGGGGGG - Intronic
906311460 1:44757476-44757498 CTCTGCAGTGGAAGGGTGGCAGG + Intronic
906524371 1:46485843-46485865 CGGGGCAGTGGCTGGGTGGTGGG - Intergenic
906581234 1:46936618-46936640 GTGTGCTGTGAGTGGGTGTGGGG + Intronic
906602490 1:47142259-47142281 GTGTGCTGTGAGTGGGTGTGGGG - Intronic
906799320 1:48722122-48722144 ATTTGGGGTGGGTGGGTGGGTGG + Intronic
907236080 1:53049172-53049194 ATGTGCAGTGGGTGGGAAGGAGG - Intronic
907267718 1:53272843-53272865 GGGGGCAGTGGGTGAGTGGGAGG - Intronic
907337463 1:53709800-53709822 CTGCTCAGTGACTGGGTGGGTGG + Intronic
907372330 1:54011526-54011548 AGGTGCAGTGGGTGGGGTGGGGG - Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907458706 1:54592626-54592648 CTTGGGAGTGGGTGCGTGGGTGG + Intronic
907473524 1:54690154-54690176 CTGTGCTGTGGGTGGTGGGGTGG - Intronic
907567451 1:55449094-55449116 TTAAGAAGTGGGTGGGTGGGAGG - Intergenic
908089176 1:60668755-60668777 CTGTCCACTGGGAGGGAGGGAGG - Intergenic
908268158 1:62398300-62398322 GAGTGGGGTGGGTGGGTGGGTGG - Intergenic
909363348 1:74791035-74791057 ATGTGAAGCGGGTGTGTGGGAGG + Intergenic
909519568 1:76551834-76551856 CTGTGAAGTGTGTGTGTGGTGGG - Intronic
909561586 1:77014462-77014484 CTGGGCAGGGCCTGGGTGGGGGG - Intronic
909593827 1:77381977-77381999 CTGTGCAGAGGGTGGGTGGAGGG - Intronic
910206267 1:84751729-84751751 CTGAGGGGTGGGAGGGTGGGAGG + Intergenic
910497587 1:87849603-87849625 GTGTGCAGCGGGGGGGTGGGGGG + Intergenic
911298300 1:96144181-96144203 CTTTGCAGTGGGTGGCTGATTGG - Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
911941058 1:104048264-104048286 CTCTGCATTGGGTTGGGGGGTGG + Intergenic
912415071 1:109502492-109502514 GTGGGTGGTGGGTGGGTGGGGGG + Intronic
912498886 1:110108760-110108782 CTGGGCAGTGTCTGGCTGGGTGG + Intergenic
912591358 1:110824295-110824317 CTGTGCTGTGGTGGGGTGGGGGG + Intergenic
913106623 1:115620289-115620311 CTGATCAGTGCGTGGGTGAGGGG + Intergenic
915177839 1:154031520-154031542 AAGCGTAGTGGGTGGGTGGGAGG - Intronic
915179633 1:154047101-154047123 AAGGGCAGTGGGTGGGTAGGGGG + Intronic
915315911 1:155029188-155029210 GGCTGCAGTGGGTGAGTGGGAGG + Intronic
915369424 1:155335895-155335917 CATTGCAGGGAGTGGGTGGGAGG - Intronic
915684505 1:157617716-157617738 GTGGGCTGGGGGTGGGTGGGGGG + Intergenic
915838984 1:159200707-159200729 TTGAGCAGTGTGTGAGTGGGTGG + Intronic
916097507 1:161364214-161364236 CATGGTAGTGGGTGGGTGGGGGG + Exonic
916102609 1:161406082-161406104 CGGTGCAGCGGGTGGGGGGGGGG + Intergenic
916442669 1:164842902-164842924 CTGTGCGGTGGGTGGGGGCGGGG - Intronic
916611597 1:166397076-166397098 CTGTGAAGTGGGTGGCTCAGAGG + Intergenic
916715517 1:167443781-167443803 GTGTGCTGTGTGTGGTTGGGTGG + Intronic
916844082 1:168630554-168630576 GTGTGCAGGGAATGGGTGGGTGG + Intergenic
916846137 1:168652101-168652123 CACTGCAGTGGGTGGGCAGGAGG - Intergenic
917413108 1:174780714-174780736 TTGTGGGGTGGGGGGGTGGGGGG - Intronic
917481678 1:175417324-175417346 GTGGGCAGTGGGTGGGAGAGGGG + Intronic
917814456 1:178693459-178693481 CTGAGCACTGGGTGTGTGGAAGG - Intergenic
917845794 1:179019265-179019287 ATGAGCAGTGGTTGGGTGGCTGG + Intergenic
918319969 1:183355056-183355078 CAGTGCAGTGGGTGGGCCAGGGG - Intronic
918393882 1:184094473-184094495 CTGTGCAGAGGATGGAAGGGTGG + Intergenic
919201502 1:194359653-194359675 TTGTGTAGTGGGCGGGGGGGGGG + Intergenic
919933472 1:202236395-202236417 CTCTGCTGTGGGTGGGAAGGAGG + Intronic
919934954 1:202245292-202245314 CTCTGAGGTGGGTGGGTGGGCGG + Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
921314380 1:213876436-213876458 TCGGGCAGGGGGTGGGTGGGAGG + Intergenic
922117410 1:222627409-222627431 TTGGGCAGTGGGTGGATAGGAGG - Intronic
922618769 1:226978296-226978318 GTGTGTGGTGGGTGGGTGGAGGG - Intronic
922791154 1:228311817-228311839 CTGAGAAGTGGGTGGGAGGGAGG + Intronic
922816354 1:228452513-228452535 CTCAGCAGTGGGTTGGTGGTGGG - Intergenic
923402361 1:233627605-233627627 CCTCGCAGTGGGAGGGTGGGCGG + Intronic
923436075 1:233969300-233969322 CTGTGCAGTGGCCGCGTGTGCGG + Intronic
923455885 1:234164829-234164851 CTGTGATTTGGGTGGGGGGGGGG + Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
924173237 1:241363110-241363132 CTGTGAAGTGGGTGTGTGTTAGG - Intergenic
1063369856 10:5514127-5514149 CTGTGCTGGGGGGTGGTGGGTGG - Intergenic
1064074586 10:12258649-12258671 ATGTGCATTGGGTGGGGTGGGGG + Intergenic
1064744041 10:18461694-18461716 GTGAGCAGTGGGTGAGTGGGTGG - Intronic
1065168593 10:23005917-23005939 CTGGGCAGAGGGAGGGTGAGGGG + Intronic
1065283976 10:24169378-24169400 TTATTCAGAGGGTGGGTGGGAGG - Intronic
1066221613 10:33340104-33340126 CATTTCAGTGGGTGGGTGTGGGG + Intergenic
1066456753 10:35578871-35578893 CTGTCCAGTGAGTGAGTGGATGG + Intergenic
1066520214 10:36209385-36209407 GTGTGTATTGGGTGGGGGGGTGG + Intergenic
1067042638 10:42963051-42963073 CTGTGCGGTTGGTTGGTGGTGGG + Intergenic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1067227760 10:44386551-44386573 CAGTGCCCAGGGTGGGTGGGTGG - Intergenic
1067723577 10:48749402-48749424 AAGTGCAGTGTGTGGGTGTGTGG - Intronic
1068569667 10:58615630-58615652 CTGAGGAGTGGGTGGATGAGTGG - Intronic
1068628736 10:59277882-59277904 CTGAGTAGAGGGTGGCTGGGTGG - Intronic
1069096164 10:64262467-64262489 TTTTGCAGAGGGTGGGTAGGAGG - Intergenic
1070697174 10:78572015-78572037 CTGGGCAGGGAGTGGGTGGTGGG + Intergenic
1070713443 10:78700288-78700310 TTGTGTACTGGGGGGGTGGGAGG - Intergenic
1070734415 10:78853568-78853590 CTGTGTAGTGTGTGGGGTGGTGG - Intergenic
1070749311 10:78954613-78954635 CTGTCAAGTGGGTGGGTTGGGGG + Intergenic
1070813489 10:79310022-79310044 CTGGGCTGTCTGTGGGTGGGTGG - Intronic
1070890765 10:79941047-79941069 ATCTCCATTGGGTGGGTGGGGGG + Intronic
1071450094 10:85785886-85785908 GTGTGTAGTGTGTGGGTGTGGGG - Intronic
1071490906 10:86135675-86135697 CTTGGCAGTGAGTGGGTGAGTGG - Intronic
1072554863 10:96507025-96507047 CTGTGCTGAGGGTCAGTGGGTGG + Intronic
1072796078 10:98355504-98355526 CAGGGCAGTGGGTGTGTGGCTGG + Intergenic
1073649527 10:105343747-105343769 CTATGGAATGGGTGGGTGGGTGG - Intergenic
1074361001 10:112824109-112824131 CTGGGCAGTGGGTGGGGATGAGG - Intergenic
1074397102 10:113107246-113107268 CTGGGTACTGGGTGGGTGGGTGG + Intronic
1074852281 10:117448440-117448462 TTGTGGAGTGGGTGGGTAGATGG + Intergenic
1074946141 10:118282634-118282656 GTGTGCAGTGTGTGTGTGGTGGG - Intergenic
1075065301 10:119285326-119285348 GAGTACAGTGGGAGGGTGGGTGG + Intronic
1075172840 10:120131863-120131885 TTGTGCTGAGGGTGGGTTGGAGG + Intergenic
1075619045 10:123912292-123912314 GTGTGCAGATGGTGGGCGGGGGG + Intronic
1075684401 10:124353679-124353701 CTGTCCTGTGGTGGGGTGGGGGG - Intergenic
1075921725 10:126218905-126218927 CTGTGCAGTTGATGGGAGGGAGG - Intronic
1076337835 10:129720438-129720460 CGGTGCTGTGGGAGGGTTGGGGG - Intronic
1076604592 10:131681274-131681296 CTCTGCACTAAGTGGGTGGGGGG - Intergenic
1076736727 10:132462338-132462360 CTGAGGAGGGGGCGGGTGGGGGG + Intergenic
1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG + Intronic
1076773305 10:132679016-132679038 CTGTGCAGGACGTGGCTGGGAGG + Intronic
1076820140 10:132934254-132934276 GTGGGCACGGGGTGGGTGGGGGG - Intronic
1077025217 11:436976-436998 GTGAGCAGTGGGTGAGCGGGAGG + Intronic
1077130889 11:971930-971952 CAGTGCCCTGGGTGCGTGGGTGG + Intronic
1077136727 11:1003258-1003280 CTGTGCTGCTGGTGGGTGGATGG + Intronic
1077169865 11:1161359-1161381 ACGTGCAGATGGTGGGTGGGTGG + Intronic
1077186267 11:1236748-1236770 GTGTGCAGTGGGTCCCTGGGTGG - Intronic
1077198394 11:1293040-1293062 GGGGGCAGTGGGTGGGTGCGGGG + Intronic
1077264265 11:1641320-1641342 CTGGGCTGTGGCTGGGTGGTTGG + Intergenic
1077281107 11:1746684-1746706 CTGGGCAGAGGCTGGCTGGGAGG - Intronic
1077359613 11:2134883-2134905 AAGTGCAGTTGGTGGGTGGCAGG - Intronic
1077402532 11:2366302-2366324 GGGTGGAGTGGGTGGGTGGTGGG - Intergenic
1077464182 11:2725783-2725805 CTGTGCTTTGGGTGGGGGCGGGG - Intronic
1077544507 11:3163513-3163535 CTGGGTAGGGGTTGGGTGGGGGG + Intronic
1077774744 11:5258522-5258544 CTGGGCAGTGGGGGGGTTGGTGG + Intronic
1077981255 11:7302976-7302998 CTGTGCAATGGGTGGGCTTGAGG + Intronic
1078081343 11:8206846-8206868 TTGTTCAGAGGGAGGGTGGGGGG - Intergenic
1078098681 11:8315943-8315965 CGGGGCAGCGGGTGGGAGGGAGG - Intergenic
1078663198 11:13303766-13303788 CTGGCCAGTGGGTGGGAGGGAGG - Intronic
1079214678 11:18498059-18498081 ATGTTGAGTGTGTGGGTGGGGGG + Intronic
1080226354 11:29965529-29965551 CCGTGAAGTGGGTGGGTGTGGGG - Intergenic
1080334079 11:31175461-31175483 CTGTGTAGTGGGTGTGTGTGTGG - Intronic
1080805597 11:35650473-35650495 GTGTACAGTGGGTGGGGGTGGGG - Intergenic
1081308474 11:41542201-41542223 GGGTACAGTGGGTGGTTGGGTGG + Intergenic
1081407181 11:42711224-42711246 ATGTGCAGTGGGTACGTGAGTGG - Intergenic
1081551909 11:44121572-44121594 CTGTGCAGTGTGGGGGCAGGGGG - Intronic
1081976412 11:47238173-47238195 CTCTGCAATGGGTGAGTAGGAGG + Exonic
1082126268 11:48434736-48434758 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1082559854 11:54605564-54605586 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1082802179 11:57423191-57423213 CTGTGTAATGGGTGGAAGGGTGG + Intronic
1083380509 11:62264540-62264562 CTGTGCACTGGGTGTGAGGCTGG + Intergenic
1083547239 11:63558169-63558191 CAGTGCAGTGGGTTGGGGGGTGG - Intronic
1083702303 11:64487457-64487479 TTGGGCAGGGGGTGGGTGAGTGG + Intergenic
1083777797 11:64902679-64902701 CTCTGCAGGGGCGGGGTGGGGGG + Exonic
1083871683 11:65492059-65492081 CTGGGCAGGGGGCGGGTAGGAGG + Intergenic
1084047643 11:66579261-66579283 GAGTGCAGTGGCTGCGTGGGAGG - Intergenic
1084179381 11:67438866-67438888 CTGAGGAGTGGGTGAGCGGGCGG - Exonic
1084182545 11:67454131-67454153 CTCTGCAGTGGGATGGTGGTGGG + Intronic
1084664560 11:70569451-70569473 CTGGGCAGAGGGTGGATGGCGGG + Intronic
1084678283 11:70649620-70649642 GTGGGCAGTGGGTGTATGGGAGG + Intronic
1084889300 11:72228854-72228876 CTGTTCAGTGGATGGGATGGGGG - Intronic
1085416900 11:76324638-76324660 CTGGAAAGTGGGTGGGTCGGAGG + Intergenic
1085464314 11:76713634-76713656 TTGGTCAGTGGGTGGATGGGTGG + Intergenic
1085514731 11:77105540-77105562 CTGGGCAGGGGGTGGATGGAAGG + Intronic
1085793933 11:79519692-79519714 CTGGGCGGCGGGTGGGGGGGGGG + Intergenic
1085800397 11:79584237-79584259 CAGTGCAGTGGGTGGGGGCCAGG + Intergenic
1085964856 11:81510416-81510438 CTGTGCAGTGTGTGTGTGTTTGG + Intergenic
1086758216 11:90592336-90592358 TTGTGGAGTGGTTGGGGGGGAGG + Intergenic
1087007846 11:93486636-93486658 CTGGGCAGTGTAGGGGTGGGTGG - Intronic
1087020534 11:93598326-93598348 CTCTGCTGGGGGTTGGTGGGGGG + Intergenic
1087363604 11:97192101-97192123 CTCTGAAAAGGGTGGGTGGGAGG - Intergenic
1087772006 11:102221023-102221045 CTGTGCAATGGGTGTTTGAGTGG + Intronic
1087853370 11:103059741-103059763 CCGAGGAGTGGGGGGGTGGGGGG + Intergenic
1088595756 11:111439047-111439069 CTGCCCAGCGGGTGGGTGTGCGG - Intronic
1089254951 11:117189266-117189288 CTCTGCTGTTGGTGGGTGTGTGG + Intronic
1089399579 11:118156687-118156709 CTGTGAGGTGGGTGTGTGTGGGG - Intergenic
1089563372 11:119357084-119357106 CCGTGCGGGGGGTGGGAGGGGGG + Intronic
1089695212 11:120212239-120212261 CAGCCCGGTGGGTGGGTGGGTGG + Intronic
1089763782 11:120748435-120748457 CTGTGTAGCGGGTGGGTAAGGGG + Intronic
1090274241 11:125408492-125408514 CCGTGCGGCAGGTGGGTGGGAGG + Intronic
1090305645 11:125688799-125688821 CAGGGCAGTGGCTGGGAGGGAGG + Intergenic
1090473656 11:127001285-127001307 GTTTCCTGTGGGTGGGTGGGTGG + Intronic
1090739094 11:129640916-129640938 CTGTGAAATGAGTGAGTGGGAGG + Intergenic
1090776331 11:129969039-129969061 CTGTGCAGCGGGGGAGTGTGTGG - Intronic
1091006143 11:131955684-131955706 CGGGGCACTGGGAGGGTGGGAGG - Intronic
1091280491 11:134379226-134379248 CTCCTGAGTGGGTGGGTGGGTGG - Intronic
1091285542 11:134406529-134406551 GTGTTGATTGGGTGGGTGGGGGG + Intronic
1091286814 11:134412430-134412452 CGGTGCCGGGGGAGGGTGGGGGG - Intergenic
1091658037 12:2360160-2360182 GTGTGGGGTGGGGGGGTGGGGGG - Intronic
1091670150 12:2446749-2446771 ATGAGTAGTGAGTGGGTGGGTGG + Intronic
1091781221 12:3215702-3215724 CTGGGAAGTGTGGGGGTGGGAGG + Intronic
1091837129 12:3593999-3594021 CTGTGAAGTGGGAGGGCTGGGGG + Intergenic
1092232018 12:6781190-6781212 AGCTTCAGTGGGTGGGTGGGTGG + Intergenic
1092258147 12:6938151-6938173 CGGGGCTGTGGCTGGGTGGGCGG + Intronic
1092806556 12:12228767-12228789 CTGGGCAGTAGCGGGGTGGGTGG - Intronic
1092913716 12:13171157-13171179 TTTGGCAGTGGGTGGGTGGGGGG + Intergenic
1094490921 12:30960111-30960133 CTGTGGTGTCTGTGGGTGGGTGG + Intronic
1094492988 12:30972798-30972820 CTGCGCAGGGGGGAGGTGGGGGG + Intronic
1094538832 12:31345925-31345947 CTGAGAAGTGGCTGGGTTGGGGG + Intergenic
1094795246 12:33964672-33964694 TTGTGGTGGGGGTGGGTGGGAGG - Intergenic
1094818922 12:34210099-34210121 CTGTGGTGTGGGTGGGTGTGGGG + Intergenic
1094838011 12:34331237-34331259 CTGTGCAGGGGCTGGGGGGAAGG + Intergenic
1095267928 12:40181527-40181549 CTGTTCAGTCAGTGGGTGTGTGG + Intergenic
1095380550 12:41585744-41585766 TTGGGCAGTGGGGGAGTGGGAGG - Intergenic
1095387315 12:41666447-41666469 TTGTGGGGTGGGTGGGGGGGAGG - Intergenic
1095777980 12:46030748-46030770 ATGTGCTGTGGGTGGGGGAGTGG - Intergenic
1096230550 12:49894464-49894486 CTGGGCTGTGGGTGGGGGAGGGG + Intronic
1096243193 12:49970305-49970327 TTGTGCAGTGGATAGGTGGCTGG + Intronic
1096480971 12:51940805-51940827 CTGTCCTGTGGATGGGTGTGTGG - Intergenic
1096524598 12:52202895-52202917 CTGTGGTGTGTGTGGGTGGGGGG + Intergenic
1096585282 12:52615832-52615854 GAGAGCAGCGGGTGGGTGGGGGG + Intronic
1096766249 12:53892723-53892745 CAGGGCAGTGGGTGGGAGGTAGG + Intergenic
1096985336 12:55752368-55752390 GTGTGTGGTGGGTGGGGGGGGGG + Exonic
1097021063 12:56021139-56021161 CAGTGAAGGGGGTGGGTGGTGGG - Intronic
1097231165 12:57512124-57512146 CTGTGCATGGGGAGGGTAGGCGG + Intronic
1097338826 12:58414735-58414757 GTGGGGAGTGGGTGGGGGGGTGG + Intergenic
1097461661 12:59871138-59871160 CTGTGCTGTGTGGGGTTGGGGGG - Intergenic
1098381980 12:69879275-69879297 CTCTGCAGCGGGTGCATGGGCGG - Intronic
1098449430 12:70602653-70602675 ATGTGCAGTGGGGGAGTGGGTGG + Intronic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099260107 12:80368384-80368406 CAGTGCAGTGTGTGTGGGGGGGG - Intronic
1099436502 12:82652575-82652597 CTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1100809545 12:98324933-98324955 CTGTGCAGTGGGTGTGGTGTGGG + Intergenic
1100938576 12:99699151-99699173 GTGTGAAGTGGGTGGCAGGGGGG - Intronic
1101719155 12:107336005-107336027 CTTTGCATTGGGCGGGTGGTGGG - Intronic
1101764328 12:107684198-107684220 GTGGGCAGTGGGGGAGTGGGTGG + Intergenic
1101785953 12:107883770-107883792 TAGTGCAATGTGTGGGTGGGGGG + Intergenic
1101838397 12:108310947-108310969 CTGGGCGGGGGGTGGGGGGGCGG - Intronic
1101941173 12:109100160-109100182 CTCTGGAGTGGGAGAGTGGGAGG - Intronic
1101967218 12:109290057-109290079 CTGCACAGTGGGTGGGTGGCAGG + Intronic
1102044640 12:109822199-109822221 GTGGGCAGTGGGGAGGTGGGTGG + Intronic
1102347181 12:112167746-112167768 CTGCGCAGTGGCTGGGGTGGCGG - Intronic
1102571625 12:113830412-113830434 CTGGAGAGTGGGTCGGTGGGTGG + Intronic
1102589486 12:113946587-113946609 CTGACCAGAGGGTGGGAGGGAGG + Intronic
1102596141 12:113993906-113993928 CTGAGTAGGGGGTGGGAGGGAGG - Intergenic
1102619471 12:114182579-114182601 GTTGGCAGCGGGTGGGTGGGTGG + Intergenic
1103235167 12:119366578-119366600 CTGTGCCCTGGGTGGGGGTGTGG + Intronic
1103563059 12:121802581-121802603 TTGTTCTATGGGTGGGTGGGGGG - Intronic
1103865506 12:124048928-124048950 ATGGGCAGTGGGTGTGTGGGTGG - Intronic
1103908589 12:124339839-124339861 GTGAGTAGTGGATGGGTGGGTGG - Intronic
1103911478 12:124354767-124354789 CTGTCCTGTGGGTGGGGCGGGGG - Intronic
1103987017 12:124774174-124774196 CTGTAGAGTGGAGGGGTGGGGGG - Intergenic
1104528087 12:129543204-129543226 TTGGTGAGTGGGTGGGTGGGTGG + Intronic
1104614587 12:130257104-130257126 CAGTGCAGTGGGTGGCTGAAGGG + Intergenic
1104849157 12:131863116-131863138 CCCTGCAGTCGGTGAGTGGGTGG - Intergenic
1104948600 12:132428579-132428601 CTGTGCCCCGGGTGGGTGGCTGG - Intergenic
1104954424 12:132457468-132457490 CGGGGGAGTGGGTGGGTGGGTGG + Intergenic
1104954530 12:132457778-132457800 CAGGTGAGTGGGTGGGTGGGTGG + Intergenic
1104963891 12:132500573-132500595 CTATGGACTGGGTGGGTGGAGGG - Intronic
1105017030 12:132792550-132792572 CTGTGCGGTGGGTCTGTGTGGGG - Intronic
1105515557 13:21087175-21087197 GTGTGTTGTGGGTGGGGGGGGGG - Intergenic
1105726619 13:23169147-23169169 CTGTGCTCTGGGTGGGAAGGGGG - Intergenic
1105821875 13:24087287-24087309 GTGTGCAGGGGGTGGGTAGCAGG - Intronic
1107119168 13:36778746-36778768 CTGTGCAGGGAGTGGGGTGGGGG - Intergenic
1107556539 13:41520731-41520753 CTGTGCCAAGGGTGGCTGGGGGG + Intergenic
1107560348 13:41552206-41552228 CTGTGCAGTGAATGGCTGGCTGG + Intergenic
1107869002 13:44729887-44729909 GTGTGCAGGGGGTGGTTGGGAGG + Intergenic
1108925113 13:55732739-55732761 CTCTGCAGTGGGTGGGGGGGGGG + Intergenic
1109267688 13:60219931-60219953 AAGTGAAGGGGGTGGGTGGGAGG + Intergenic
1109451988 13:62528014-62528036 CTATCTATTGGGTGGGTGGGTGG - Intergenic
1109915777 13:68983556-68983578 TTGTTCAGTGAGTGGGAGGGAGG + Intergenic
1110281508 13:73699186-73699208 GATTGCAGTGGGGGGGTGGGGGG - Intronic
1111381840 13:87464834-87464856 TTGGCCAATGGGTGGGTGGGTGG + Intergenic
1111784165 13:92766285-92766307 TGGTGGTGTGGGTGGGTGGGTGG - Intronic
1112286750 13:98111525-98111547 CAGTGCAGTATGTGGGTGAGAGG - Intergenic
1113113394 13:106848641-106848663 TTCTGCAGAGGGTGGGGGGGCGG - Intergenic
1113468933 13:110530787-110530809 CTGTGTAGAGGTGGGGTGGGTGG - Intronic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1114486738 14:23067405-23067427 CTGTGCAATTGGTGGGGGGTTGG + Intronic
1114631085 14:24160056-24160078 TCTTGCAGTGGGTGGGAGGGAGG + Intronic
1114743218 14:25119397-25119419 CTTTGATCTGGGTGGGTGGGAGG + Intergenic
1117016617 14:51525003-51525025 TTGTGTGTTGGGTGGGTGGGTGG + Intronic
1117016619 14:51525007-51525029 GTGTTGGGTGGGTGGGTGGGTGG + Intronic
1117031748 14:51678831-51678853 TTTTGGAGTGGGTGGGTGGGTGG + Intronic
1117252269 14:53949931-53949953 CTGTGTAGTGTGTGGGTGAGTGG + Exonic
1117773835 14:59162049-59162071 CTGAGCATGGGGTGGGAGGGTGG + Intergenic
1118114287 14:62757802-62757824 ATGGGTAGTGGGTGGATGGGAGG + Intronic
1118371606 14:65141942-65141964 GGTGGCAGTGGGTGGGTGGGTGG - Intergenic
1118441722 14:65818190-65818212 GTGTGCAGTGTGTGTGTGTGTGG - Intergenic
1118489145 14:66242550-66242572 TTGGGTAGTGTGTGGGTGGGTGG - Intergenic
1119054352 14:71403987-71404009 CTGTGATGTGGGTGGGTGGGTGG - Intronic
1119437949 14:74610545-74610567 CTGGGCAGTGAGGGGCTGGGTGG - Intronic
1119488738 14:75011399-75011421 TTGTGCAGTGTCTGTGTGGGTGG + Exonic
1119702197 14:76762744-76762766 CTCTGCAGCCGGTGTGTGGGAGG + Exonic
1119887080 14:78152154-78152176 TTGTGGGGTGTGTGGGTGGGAGG + Intergenic
1120033371 14:79667897-79667919 CTCTGCTGTGAGTGGGTGGCCGG + Intronic
1120067534 14:80060969-80060991 GTTTGGGGTGGGTGGGTGGGTGG + Intergenic
1120106602 14:80502366-80502388 CTGTGCAGTGGGTGTTTGTTGGG + Intronic
1120712294 14:87805429-87805451 CTGTGCAGTGTCTCGGTGAGAGG + Intergenic
1120860075 14:89247074-89247096 CTGACTATTGGGTGGGTGGGTGG - Intronic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121238518 14:92411325-92411347 CTGATCATGGGGTGGGTGGGAGG - Intronic
1121424066 14:93835685-93835707 CCCTGTAGTGGGTGGGTGGGTGG + Intergenic
1121569413 14:94936242-94936264 CTGATCGGTGGGTGGGTGGGTGG - Intergenic
1121630050 14:95415286-95415308 CAGAGCAGTGGCAGGGTGGGTGG - Intronic
1121752089 14:96365458-96365480 CTGGGCAGTTTGGGGGTGGGGGG + Intronic
1121867063 14:97372448-97372470 CTGCCCAGTTGGTGGGTAGGAGG + Intergenic
1122056016 14:99098898-99098920 CTGTGCCGTGGGGGAGTCGGGGG - Intergenic
1122059594 14:99127941-99127963 CTGTAATGGGGGTGGGTGGGGGG - Intergenic
1122110451 14:99497001-99497023 CTGTGCATGTGTTGGGTGGGGGG - Intronic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122218934 14:100222885-100222907 TTATACAGTGGGTGGATGGGGGG + Intergenic
1122249449 14:100427782-100427804 CTGGGCAATGGGTGGGGTGGTGG - Intronic
1122358092 14:101136340-101136362 CTGTGCAGGTGGGGGCTGGGAGG - Intergenic
1122542063 14:102504210-102504232 CTGGGCACCTGGTGGGTGGGTGG + Exonic
1122606215 14:102948623-102948645 CTGTGGAGAGGGGGAGTGGGGGG + Intronic
1122779422 14:104137428-104137450 CTGGGGAGTGCGTGCGTGGGCGG + Intergenic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1122812289 14:104295066-104295088 CTGTGGTGGGGATGGGTGGGGGG + Intergenic
1122882269 14:104695470-104695492 GTGTGCAGGGCCTGGGTGGGTGG - Intronic
1122912309 14:104836848-104836870 CGGTGCAGGGGGGGGGGGGGGGG - Intergenic
1123114913 14:105890273-105890295 GTGTGCAGATGGGGGGTGGGGGG + Intergenic
1123118923 14:105908151-105908173 ATGGGCAGTGTGTGGGTGCGAGG + Intergenic
1123505794 15:20940901-20940923 CTCAGCAGCGGGTGGGGGGGGGG + Intergenic
1123563029 15:21514607-21514629 CTCAGCAGCGGGTGGGGGGGGGG + Intergenic
1123599276 15:21951890-21951912 CTCAGCAGCGGGTGGGGGGGGGG + Intergenic
1123699406 15:22903365-22903387 ATGGGCGGTGGGTGGGAGGGTGG + Intronic
1123869327 15:24555256-24555278 CTGTGCCCTGGGTGGCGGGGGGG - Intergenic
1124007280 15:25804627-25804649 GTGTGGAGTGGGTGGCCGGGTGG - Intronic
1124201402 15:27681461-27681483 CAGTGCAGCGGGTGGGAGGAGGG - Intergenic
1124656804 15:31515749-31515771 CAGTTGTGTGGGTGGGTGGGTGG - Intronic
1124839748 15:33230570-33230592 CAGTGCAGTGAAGGGGTGGGGGG - Intergenic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1125313798 15:38409535-38409557 CTATGGAGTGGGGGGGGGGGGGG - Intergenic
1125323605 15:38514106-38514128 TTGTACAGGAGGTGGGTGGGTGG + Intronic
1125576204 15:40757315-40757337 CTGTGGAGGGGGTGGGAAGGTGG - Intergenic
1127637919 15:60888908-60888930 CCGAGGAGTGGGAGGGTGGGTGG + Intronic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1127977544 15:64009331-64009353 GTGTGGATTGGGTGTGTGGGTGG - Intronic
1128157588 15:65401597-65401619 GAGTGCAGAGAGTGGGTGGGAGG + Intronic
1128254489 15:66186674-66186696 CTGTCCATGGGGTGAGTGGGTGG - Intronic
1128311635 15:66634595-66634617 CTGTGCAGTGGTTAGGTTGCAGG + Intronic
1128318195 15:66674571-66674593 CAGTGCAGGGGATGGGTTGGAGG - Intronic
1128344618 15:66845558-66845580 CCGCACAGTGGGGGGGTGGGCGG + Intergenic
1128547878 15:68579652-68579674 CTGAGCAGTGGGTGTGGGGATGG + Intronic
1129222191 15:74137412-74137434 GTGTGCGTTGTGTGGGTGGGTGG + Intronic
1129366450 15:75058530-75058552 GTGGGGAGTGGGTGGGTGTGAGG + Intronic
1130022313 15:80241776-80241798 TTGTGCTGTGGGTGGAAGGGAGG - Intergenic
1130251702 15:82304228-82304250 CATTGCCCTGGGTGGGTGGGTGG + Intergenic
1130398765 15:83529703-83529725 CTGCTCAGTGGGTGGGGCGGGGG + Intronic
1130429335 15:83830954-83830976 TTGCCAAGTGGGTGGGTGGGTGG + Intronic
1130462398 15:84168874-84168896 CTGAACTGTGGGTGGATGGGTGG - Intergenic
1130474017 15:84247796-84247818 CTGAACTGTGGGTGGATGGGTGG - Intergenic
1130481432 15:84361864-84361886 CTGAACTGTGGGTGGATGGGTGG - Intergenic
1130501866 15:84504669-84504691 CTGAACTGTGGGTGGATGGGTGG + Intergenic
1130648908 15:85751233-85751255 CTGTGCAGAGGCTGGATGAGGGG - Intergenic
1130652478 15:85769911-85769933 GTGAGCAGAGAGTGGGTGGGAGG - Intronic
1130770089 15:86915642-86915664 TGGTGCAGTGGGGCGGTGGGGGG - Intronic
1130908740 15:88256944-88256966 CCGGCGAGTGGGTGGGTGGGTGG - Intergenic
1130937510 15:88482774-88482796 CTGTCCACTGGGTGGGAGGTGGG + Intergenic
1131508691 15:93037030-93037052 CTGGGCAGTGGGTGACTGGCAGG + Intronic
1131814299 15:96206419-96206441 TTGTGGAGTGGGGGGGAGGGGGG + Intergenic
1131900047 15:97077914-97077936 CTGGGCAGAAGGTGGGTGGAGGG - Intergenic
1131957743 15:97755608-97755630 GTGTGTGTTGGGTGGGTGGGTGG - Intergenic
1132406145 15:101542834-101542856 CAGTGCTGGGGTTGGGTGGGGGG - Intergenic
1132406158 15:101542870-101542892 CAGTGCTGGGGTTGGGTGGGGGG - Intergenic
1132439281 15:101842376-101842398 CAGTGCTGTGGGTGGTCGGGGGG + Intergenic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1132590428 16:724045-724067 TGGGGCAGTGGGTGGGTGGGGGG + Intronic
1132663444 16:1071481-1071503 CACTGCTGTGGGAGGGTGGGAGG + Intergenic
1132712487 16:1275738-1275760 CTGTGCTGTGCGTGTGTGTGTGG - Intergenic
1132826471 16:1907900-1907922 CTGTGGAGAGGGTGGGTGCAGGG + Intergenic
1133767881 16:8850426-8850448 CTGAGCAGTGGGTGAGTGCAGGG + Intergenic
1134224398 16:12380376-12380398 ATGAGGGGTGGGTGGGTGGGTGG - Intronic
1134224409 16:12380403-12380425 ATGAGGGGTGGGTGGGTGGGTGG - Intronic
1134224673 16:12381210-12381232 ATGAGGGGTGGGTGGGTGGGTGG - Intronic
1134224801 16:12381649-12381671 GGGTGGGGTGGGTGGGTGGGTGG - Intronic
1134285954 16:12862403-12862425 GTGAGCAGTGGGTGAGCGGGAGG - Intergenic
1134443104 16:14310993-14311015 GGCTGCAGGGGGTGGGTGGGGGG - Intergenic
1135051759 16:19198972-19198994 CTGAGTGGTCGGTGGGTGGGTGG + Intronic
1135235901 16:20755777-20755799 CTGTGGGGTGGGGGGGGGGGAGG - Intronic
1135473547 16:22753431-22753453 CTGTTCACTGGGTGTGTGGAAGG + Intergenic
1135941782 16:26828167-26828189 CTGTGCAGAGAGTGTGTGTGGGG + Intergenic
1136087857 16:27898346-27898368 CCTCGCAGGGGGTGGGTGGGCGG - Intronic
1136133783 16:28241734-28241756 CATTGCGGTGGGTGGGGGGGGGG - Intergenic
1136537687 16:30910181-30910203 CTGTTCACTGGGTGAGTGAGGGG - Intergenic
1136556925 16:31012379-31012401 CTGTGCTTTGAGTGGCTGGGTGG - Intergenic
1136751268 16:32637941-32637963 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1137395356 16:48113272-48113294 CTGGGCAGTTAGTGGGAGGGAGG - Intronic
1137731700 16:50694540-50694562 CTCTGCACTGGGTAGGAGGGAGG - Intronic
1139267862 16:65656665-65656687 CTGTCCACAGGGTGGCTGGGAGG + Intergenic
1139467079 16:67159813-67159835 TAGTGCAGCAGGTGGGTGGGTGG - Intronic
1139587509 16:67913584-67913606 CTGTGAAGTGAGTGGCTGGAAGG + Intronic
1139587825 16:67915688-67915710 CTGTGAAGTGAGTGGCTGGAAGG - Intronic
1139946840 16:70647627-70647649 CTCTGCAGTGGGCACGTGGGAGG - Intronic
1140326100 16:74005121-74005143 AAGTGGTGTGGGTGGGTGGGTGG + Intergenic
1140712939 16:77695121-77695143 CTTTTTAGGGGGTGGGTGGGCGG + Intergenic
1140864923 16:79051562-79051584 CTGTGTGCTGGGTGGGTGGGAGG + Intronic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141382031 16:83585394-83585416 CTGTTCAGTGGGTGTGGGAGAGG + Intronic
1141526217 16:84613825-84613847 CTCTGGAGTGGGTGGGGGGCGGG - Intronic
1141607866 16:85165537-85165559 CTGTGCAGTGTGTGGTCTGGAGG + Intergenic
1141690958 16:85595932-85595954 CGGAGGAATGGGTGGGTGGGTGG - Intergenic
1141790477 16:86231019-86231041 CTCTGGAGGGGGTGGGTGTGGGG - Intergenic
1142142705 16:88479699-88479721 CTGGGTAGCAGGTGGGTGGGGGG - Intronic
1142281998 16:89153654-89153676 CTGGGGAGTGGGTGGGCAGGTGG - Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1203053402 16_KI270728v1_random:897196-897218 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1143117162 17:4587590-4587612 CTGTGTAGTGGGGGTCTGGGTGG + Intronic
1143151513 17:4809805-4809827 CTGGGCAGTGGGTGGGGGTGAGG + Intronic
1143598168 17:7928152-7928174 GTGTGCAGTGAGGGGCTGGGAGG + Intronic
1143598714 17:7930496-7930518 CTGGGCAGGGGGTGGGGGTGCGG + Exonic
1143762659 17:9116300-9116322 CTGGTGGGTGGGTGGGTGGGTGG - Intronic
1143763056 17:9118641-9118663 CTGGAAAGGGGGTGGGTGGGAGG - Intronic
1143863070 17:9905204-9905226 CTGGGGAGTCGCTGGGTGGGTGG + Exonic
1144178995 17:12734452-12734474 GCATGCAGTAGGTGGGTGGGTGG - Intronic
1144440990 17:15281505-15281527 TGGTGCAGAGGGTGGGGGGGCGG - Intergenic
1144773652 17:17773054-17773076 CTGATGGGTGGGTGGGTGGGTGG + Intronic
1145267977 17:21389641-21389663 CTCTGCAGAGGGTGGGGGTGTGG + Intronic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1145850862 17:28094642-28094664 CTTTGAGGTGGGTGGGTGGTGGG + Intronic
1145933607 17:28702581-28702603 CTGTGCTGTGGGTGAGTGAGTGG - Exonic
1146845873 17:36181889-36181911 GCCTGCAGTGGGTGGTTGGGTGG + Intronic
1147214677 17:38892344-38892366 CTGTGCCGCAGGTGGGTGGGTGG - Intronic
1147324943 17:39665648-39665670 CTGGGCACAGGCTGGGTGGGGGG - Intronic
1147544793 17:41393091-41393113 CTGTGCAGACGCTGGGTGGTGGG - Intronic
1147846274 17:43406237-43406259 TTGTGTAGAGGTTGGGTGGGAGG + Intergenic
1147986876 17:44311954-44311976 CTGGGCAGCTGGTGTGTGGGAGG + Intronic
1148005999 17:44430076-44430098 TTATGTAGTGGGTGGGTGGGTGG - Intronic
1148049992 17:44765186-44765208 CATTGCCGGGGGTGGGTGGGGGG + Intronic
1148050002 17:44765211-44765233 CTGGCAGGTGGGTGGGTGGGTGG + Intronic
1148244266 17:46020298-46020320 CTGTGCAGTGAGGGTGTGTGTGG + Intronic
1148524090 17:48313139-48313161 CGGGGCGGTGGGGGGGTGGGAGG + Intronic
1148590377 17:48812066-48812088 CTGAGCGGGGGGTGGGGGGGGGG - Intronic
1149243686 17:54680571-54680593 CGTTGCAGTGGGTGGGTGGGCGG - Intergenic
1149549153 17:57527265-57527287 CTGGGGTGTGGGTGGGTGGGTGG - Intronic
1149572372 17:57682320-57682342 CTTCACAGTGGGTGGGGGGGGGG - Exonic
1149685210 17:58531257-58531279 CTCTGCAGTGTGTGGGGGTGGGG - Intronic
1149738683 17:59021626-59021648 GAGTGTAGTGGGTGGCTGGGGGG + Intronic
1149849074 17:60024830-60024852 GCCTGCAGTGGGTGGTTGGGTGG + Intergenic
1149861094 17:60121694-60121716 GCCTGCAGTGGGTGGTTGGGTGG - Intergenic
1150195465 17:63293774-63293796 CTGCACTCTGGGTGGGTGGGTGG - Intronic
1150362327 17:64547553-64547575 CTGGGCAGCGGGTGGGGGCGGGG - Intronic
1151360633 17:73586595-73586617 GACTGCAGGGGGTGGGTGGGTGG + Intronic
1151537519 17:74747353-74747375 CTTTGAAGTGAGTGGGGGGGGGG + Intergenic
1151788217 17:76287011-76287033 GTGGGCAGGGGGTGGGGGGGCGG - Intronic
1151815181 17:76468247-76468269 CTGTGCAGTGGGTGGGCGCCCGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151888557 17:76938487-76938509 CTGGGGGGTGGTTGGGTGGGTGG + Intronic
1152033561 17:77858276-77858298 ATGAGGGGTGGGTGGGTGGGTGG - Intergenic
1152083951 17:78205894-78205916 CTGAGCAGTGGGAGGGGAGGTGG - Intronic
1152112694 17:78365967-78365989 GCGGGCAGTGGGTAGGTGGGTGG - Intergenic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152238269 17:79149532-79149554 CTGTGAAGTGGGTGGGGCAGTGG + Intronic
1152589683 17:81205396-81205418 CGGGGCAGTGGGTGGGGGGTAGG + Intronic
1152634018 17:81423140-81423162 CTCTGCGGCGGGTGGGCGGGTGG - Intronic
1152635393 17:81428676-81428698 CTGCTCAGAGGGTGGGTGTGTGG + Intronic
1152783593 17:82237007-82237029 CTCTCGAGTGGGTGGGTGGCAGG + Intronic
1152892800 17:82892024-82892046 CTGTGCAGGGGGGAAGTGGGGGG - Intronic
1153150687 18:2089463-2089485 GTGGGCAGCGGGTGAGTGGGTGG - Intergenic
1153835927 18:8963698-8963720 GTGTGCAGTGTGTGTGTGTGTGG - Intergenic
1154377717 18:13823282-13823304 TGGGTCAGTGGGTGGGTGGGTGG - Intergenic
1154377732 18:13823329-13823351 TGGGTCAGTGGGTGGGTGGGTGG - Intergenic
1154377856 18:13823849-13823871 TGGTTGAGTGGGTGGGTGGGTGG - Intergenic
1155103580 18:22638717-22638739 CTGTGGAGAGGGTTGGTTGGGGG + Intergenic
1156036840 18:32773582-32773604 CAGTGCTGGGGGTGGGGGGGAGG - Exonic
1156476771 18:37410436-37410458 GTGTGGAGTGGGTGGGCCGGGGG - Intronic
1156506686 18:37600285-37600307 CTTTGCTCTGGGTGGGTGGGGGG - Intergenic
1157295306 18:46437884-46437906 GTGGGCAGAGGGTGGGTGGAGGG + Intronic
1157452848 18:47801201-47801223 CCCTGCAGTGGGGGGGTTGGAGG - Intergenic
1157675824 18:49567989-49568011 CTGTGCTGAGGGTGGGGAGGGGG + Intronic
1157980436 18:52373569-52373591 CTGTACATTGTGGGGGTGGGTGG + Intronic
1157990247 18:52487118-52487140 CTGTGGACTGGGAGGGTTGGTGG + Intronic
1158524237 18:58197918-58197940 CTCTCCAGTGGGTGGGGGTGGGG + Intronic
1158623212 18:59050122-59050144 GTGTCCGGTGGGTGGGAGGGCGG - Intergenic
1160240396 18:77118586-77118608 CTGTGGAGTGTGTGTGTGGGTGG - Intronic
1160279193 18:77471289-77471311 TCGTGCAGAGGGAGGGTGGGGGG + Intergenic
1160506130 18:79427694-79427716 CTGTGCAGTGGGTGGGGTTGGGG + Intronic
1160506186 18:79427879-79427901 CTGTGCAGTGAGTCGGGGAGGGG + Intronic
1160506207 18:79427953-79427975 CTGTGCAGTGGGTGGCGGGGGGG + Intronic
1160632873 18:80258670-80258692 GTGTGGGGTGGGTGGGTGGGGGG + Intergenic
1160699487 19:498914-498936 CTGTGCTGTGGGGCGCTGGGAGG + Intronic
1160714635 19:570675-570697 GGGTGGGGTGGGTGGGTGGGGGG + Intergenic
1160717420 19:582612-582634 AGGTGTGGTGGGTGGGTGGGCGG + Intronic
1160926818 19:1550416-1550438 ATGTTGAATGGGTGGGTGGGTGG - Intergenic
1160970582 19:1766180-1766202 AGGTGCTGTGGGTGGGTGGGTGG - Intronic
1161026425 19:2039346-2039368 GTGAGCAGAGGGTAGGTGGGTGG - Exonic
1161066105 19:2238473-2238495 AGGTGCAGTGGGTGGATGGGAGG - Intronic
1161123009 19:2540504-2540526 CTGTGCAGAGGGTGGGTGCGTGG + Intronic
1161176383 19:2844801-2844823 CTGTGCAGTGGGCTAGGGGGTGG - Intronic
1161237748 19:3206201-3206223 CAGGCCAGTGGGTGGGTGGGTGG + Intronic
1161399079 19:4059640-4059662 CCTTGCCCTGGGTGGGTGGGGGG - Intronic
1161482866 19:4519466-4519488 CTGGGCTGTCTGTGGGTGGGTGG + Intergenic
1161525222 19:4750582-4750604 AAGGGCAGTGGGTGGGTGAGAGG - Intergenic
1161974054 19:7599257-7599279 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1161974100 19:7599424-7599446 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1161974109 19:7599457-7599479 GAGTGGGGTGGGTGGGTGGGTGG - Intronic
1161974160 19:7599640-7599662 GAGTGGGGTGGGTGGGTGGGTGG - Intronic
1162132651 19:8536642-8536664 CAGTCCTGGGGGTGGGTGGGAGG + Intronic
1162332482 19:10038832-10038854 TTGGGCAGTGGCGGGGTGGGGGG - Intergenic
1162479731 19:10921303-10921325 CTGTGCATGGGCTGGGTGGCTGG + Intronic
1162781497 19:13009300-13009322 CTGGGCAGCGGGTGGGTGGGGGG + Intronic
1163268347 19:16234539-16234561 CTGGGCAGAGGCTGGGAGGGTGG - Exonic
1163384249 19:16989641-16989663 ACCTGCAGTGGGTGGGAGGGTGG + Exonic
1163443512 19:17333653-17333675 CTGGGCACTGGGCGGGCGGGCGG + Intronic
1163528737 19:17837099-17837121 GGGTGGGGTGGGTGGGTGGGGGG + Intronic
1163571600 19:18085335-18085357 CTCAGGGGTGGGTGGGTGGGTGG - Intronic
1163671123 19:18629313-18629335 CCTGGTAGTGGGTGGGTGGGTGG + Intergenic
1163704122 19:18802574-18802596 CACTGCAGTCGGTGGGTGGAGGG + Intergenic
1163719953 19:18894240-18894262 GAGTGCGGTGGGTGGGTGGGTGG + Intronic
1163760312 19:19132894-19132916 CAGTCCTGTGGGTGGGTGGGGGG - Intronic
1163796710 19:19342181-19342203 CTGTGCTCTGAGGGGGTGGGAGG - Intronic
1164540007 19:29115267-29115289 TGCTCCAGTGGGTGGGTGGGTGG - Intergenic
1164576325 19:29407374-29407396 CTGTAGAGTGAGTGGGTGGGTGG + Intergenic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1164685972 19:30167174-30167196 CCGTGTTCTGGGTGGGTGGGTGG + Intergenic
1164816741 19:31209895-31209917 GTGTGGAGTGGTTGGGTGGGGGG + Intergenic
1164891797 19:31829742-31829764 CAGAGGTGTGGGTGGGTGGGGGG - Intergenic
1165031432 19:33000551-33000573 CTGTGTGGTGGGTGAGTTGGAGG - Intronic
1165094183 19:33401698-33401720 GTGAGCAGCGGGTCGGTGGGGGG - Intronic
1165263800 19:34643411-34643433 CTGGGAAGGGTGTGGGTGGGGGG + Intronic
1165381652 19:35485910-35485932 CTTTGCAGTGGATGGATGGATGG + Intergenic
1165394186 19:35555346-35555368 GGGTGCAGGTGGTGGGTGGGTGG + Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165902405 19:39174908-39174930 CTGTGCAGGGGCTGGGTCAGTGG - Intronic
1165950605 19:39472292-39472314 CTGGGGTGTGGGTGGCTGGGTGG + Intronic
1166303295 19:41923907-41923929 CTGTGCTGGGGGTGTGTGTGGGG + Intronic
1166313847 19:41977847-41977869 CAGTGCAGAGGGAGGTTGGGGGG + Intronic
1166316150 19:41991350-41991372 GGGTGCAGGGGGTGGGAGGGAGG + Intronic
1166347288 19:42174728-42174750 GTGTGCAGTGGGGGGCTGGTGGG - Intronic
1166347296 19:42174761-42174783 GTGTGCAGTGGGGGGCTGGTGGG - Intronic
1166380136 19:42351347-42351369 GGGTGCAGGGAGTGGGTGGGTGG + Intronic
1166732822 19:45068315-45068337 TTGTGCGGGGGGGGGGTGGGGGG - Intronic
1166852153 19:45766181-45766203 CTGTGCAGCTGGAGGGCGGGCGG + Intronic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1166942248 19:46374100-46374122 CTGGGCTGTGGGTGGGTGTAAGG - Intronic
1167107919 19:47441441-47441463 CTGTGCAGGGGGTAAGGGGGAGG + Intronic
1167463136 19:49636781-49636803 CGGAGCAGTGGGTGGGTGTGGGG - Intronic
1167471271 19:49677591-49677613 CTGCGCGGTGGGTGGGGAGGGGG + Intronic
1167610760 19:50506782-50506804 GTGGACGGTGGGTGGGTGGGTGG - Intronic
1167610768 19:50506801-50506823 GTGGACGGTGGGTGGGTGGGTGG - Intronic
1167620200 19:50556273-50556295 AGGTGCAGTGGGTGGGGGTGAGG + Intronic
1167711042 19:51111248-51111270 CTAGACAGTGGGTGGGTGGGGGG - Intergenic
1168308552 19:55449855-55449877 CTGGGCAGGGGGCTGGTGGGGGG - Intergenic
1168308892 19:55451179-55451201 GTCCGCAGGGGGTGGGTGGGGGG + Intergenic
1168405500 19:56108306-56108328 CTGGGCAGGGGCTGGGTGGTGGG - Intronic
1168405528 19:56108376-56108398 CTGGGCAGGGGTTGGGTGGAGGG - Intronic
1168467080 19:56611560-56611582 CTGTGCAGAGTGTGGAAGGGGGG + Intronic
1168498911 19:56876987-56877009 CTGTGTCATGGGTGGGAGGGAGG - Intergenic
1168640952 19:58031250-58031272 GGTTGCAGTGGGTGAGTGGGTGG - Intergenic
1168694021 19:58395053-58395075 CTGTGGTCTGGGTGGATGGGTGG + Intergenic
1168724312 19:58572407-58572429 CTTCGCAATGGGTGGGGGGGCGG + Intronic
1202715065 1_KI270714v1_random:37869-37891 CTGTGCGGTGGGAGGGAGGGAGG - Intergenic
925163405 2:1702296-1702318 CTGTGCCGGGGTTGGGGGGGTGG - Intronic
925797185 2:7558543-7558565 GTGTGGAGTGTGTGGGTAGGTGG - Intergenic
925939019 2:8797198-8797220 CTGGGCTGTGGGTTGGTCGGTGG - Intronic
927424937 2:22971098-22971120 CTGTGGGGGGGGTGGGGGGGGGG + Intergenic
927499765 2:23574943-23574965 CTGAGGAATGGGTGGGAGGGTGG + Intronic
927663412 2:25012113-25012135 GTATGCAGTGAGTGGGTGGTAGG + Intergenic
928086298 2:28348325-28348347 CTGTCTAGTGGGTGGGTGCCAGG - Intergenic
928439936 2:31284022-31284044 CTGGGAAGTGGCTGGGTGGGAGG - Intergenic
929041622 2:37750170-37750192 GTGTGGGGTGGGTGGGTGAGGGG - Intergenic
929569859 2:43015693-43015715 CAGTGCTGTGGGTAGGTGTGGGG - Intergenic
929720290 2:44361309-44361331 CTGAGGGGTGGGTGGCTGGGCGG + Intronic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
930270831 2:49254601-49254623 CTGTGTGGTGGGTGGCGGGGAGG + Intergenic
930443420 2:51438203-51438225 GTGTGCAGTGGGTGGAGGGGAGG + Intergenic
930641610 2:53859606-53859628 AGGGGCGGTGGGTGGGTGGGTGG + Intronic
930673841 2:54179237-54179259 GTGAGGGGTGGGTGGGTGGGTGG + Intronic
930824981 2:55687803-55687825 TGGTGGAGTGGGTGGGTTGGGGG - Intronic
931786027 2:65620144-65620166 CTGTGCAGAGGGTTGGGGCGGGG + Intergenic
931835402 2:66093787-66093809 CTGTGGAGTGAGTGTGTGGAAGG + Intergenic
931976189 2:67646657-67646679 CTGTGCTGTGGGTGGTGGGAAGG - Intergenic
932427086 2:71644945-71644967 GTGTGCAGTGGGGGTGTGGCTGG + Intronic
932580166 2:72988211-72988233 GTGTGCTGTGGGTGGGTGTGGGG - Intronic
932904796 2:75738333-75738355 GTTTGCAGTGGGCGGGTGGGAGG - Intergenic
933566656 2:83958303-83958325 ATGGGGGGTGGGTGGGTGGGAGG + Intergenic
934035598 2:88086374-88086396 GTGTGCAGTCAGTGGGTGGCAGG + Intronic
936899904 2:117470701-117470723 CTGTGGTGGTGGTGGGTGGGGGG + Intergenic
937061345 2:118982419-118982441 GGGTGCAGTGGGTGAGTAGGTGG + Intronic
937067456 2:119028639-119028661 CGATGGAGTGGGTGGCTGGGCGG + Intergenic
937077115 2:119115027-119115049 GTGCTCACTGGGTGGGTGGGTGG - Intergenic
937150734 2:119683909-119683931 TCATGCAGTGGGAGGGTGGGAGG - Intronic
937977054 2:127588741-127588763 ATGGGTAGTGGGTGGGTGGATGG + Intronic
938287240 2:130128551-130128573 CTGTGGAGGGGGTGGTTGGGGGG - Intronic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
938469260 2:131544322-131544344 CTGTGGAGGGGGTGGTTGGGGGG + Intergenic
938972591 2:136446098-136446120 CGGGGTTGTGGGTGGGTGGGAGG - Intergenic
939208187 2:139134839-139134861 CTGTGAGGTGGGTGGGTTGGGGG - Intergenic
939309952 2:140463169-140463191 GTGGCCAGTGGGAGGGTGGGTGG + Intronic
940308003 2:152247127-152247149 CTGTGCAGGGGGTAGGGTGGGGG - Intergenic
942461361 2:176171016-176171038 CTTTGCTGGGGGTTGGTGGGGGG + Intronic
942959455 2:181812499-181812521 CTGTGCAGTTGGTGGGCTGAAGG + Intergenic
944964681 2:204917179-204917201 ATGAGGAGTTGGTGGGTGGGTGG + Intronic
945147411 2:206752926-206752948 AGGGGCAGGGGGTGGGTGGGTGG - Intronic
946208844 2:218130959-218130981 CTGTGCTGGGGGTGGGCTGGAGG - Intronic
946229316 2:218281948-218281970 ATGGGCATCGGGTGGGTGGGGGG + Exonic
946388655 2:219402022-219402044 GTGTGCAGGGGGTGGGTGGTGGG - Intergenic
946797727 2:223373402-223373424 CAGAGGAGTGGGTGTGTGGGGGG + Intergenic
946823941 2:223657229-223657251 GTGTGCAGGGGGTGGGAGTGAGG - Intergenic
947195655 2:227564237-227564259 ATCTGTATTGGGTGGGTGGGTGG + Intergenic
947611900 2:231530056-231530078 CTGTGCAGCGGGGGTGAGGGCGG - Intronic
948211128 2:236193916-236193938 CAGTGTTGTGTGTGGGTGGGTGG + Intergenic
948279552 2:236736357-236736379 CAGGGCAGGGGGTGGCTGGGGGG + Intergenic
948494731 2:238340039-238340061 GTGTGCGGTGGGTGGCGGGGCGG + Intronic
948666190 2:239536159-239536181 CTGGGGAGTTGGTGGGGGGGTGG + Intergenic
948695676 2:239732066-239732088 GGGTGGAGTGGGAGGGTGGGAGG - Intergenic
948714498 2:239852012-239852034 CTGTTCCCTGGGTGGGGGGGTGG + Intergenic
948718248 2:239880271-239880293 CAGTGCATGGGGTGGGGGGGTGG - Intergenic
948753808 2:240147145-240147167 CTGTGTATTGTGTGTGTGGGGGG + Intergenic
948753842 2:240147407-240147429 GTGTTAAGTGGGTGGGTGTGGGG + Intergenic
948804905 2:240449317-240449339 CTTTGCAGCGTGGGGGTGGGGGG - Intronic
948850737 2:240704151-240704173 CAGTGCAGCGGGTGGGGAGGAGG + Intergenic
1168944293 20:1738739-1738761 CCCTGCAGAGGGTGGGGGGGTGG + Intergenic
1169028708 20:2391489-2391511 CTGAGCTGTGAGGGGGTGGGGGG + Intronic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169267003 20:4172790-4172812 CTGGAGGGTGGGTGGGTGGGAGG + Intronic
1169660429 20:7972910-7972932 CTGGGGAGGAGGTGGGTGGGAGG - Intergenic
1170409899 20:16077751-16077773 AAGTGCAGTGGGGGGTTGGGAGG - Intergenic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1171194800 20:23188205-23188227 GTGTGCATTGTGTGTGTGGGGGG + Intergenic
1171233680 20:23507946-23507968 CTGGACAGTGTGGGGGTGGGGGG - Intergenic
1171290920 20:23982416-23982438 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1171429253 20:25070443-25070465 GTGTGCAGGGGGTTGGGGGGGGG - Intergenic
1172177363 20:32980449-32980471 CTGGACTGGGGGTGGGTGGGAGG + Intergenic
1172296861 20:33818372-33818394 CTGGGCATTGGATGGGTGGCTGG - Intronic
1172771279 20:37384069-37384091 CTGTGGAATGGGTGGGAGGGAGG + Intronic
1172822926 20:37754443-37754465 CTCCACAGTGGGTGGATGGGTGG + Intronic
1173025758 20:39305901-39305923 CTGTGCTGGGGGTGGGTGGGAGG + Intergenic
1173340105 20:42145622-42145644 CTATGCAGTGGCTGAGTAGGTGG + Intronic
1173660508 20:44730000-44730022 CTGTGCAGTGGTAGAGTGAGTGG + Intergenic
1173714150 20:45187724-45187746 CTCTGCAGTTGTTGTGTGGGTGG - Intergenic
1173833778 20:46111596-46111618 CAGTGCAGGGGGTGGGGGAGAGG + Intergenic
1173993375 20:47319853-47319875 CTGCTGAGGGGGTGGGTGGGTGG - Intronic
1173999346 20:47362968-47362990 CTGTGCAGTGATTGAGTGTGTGG + Intergenic
1174115824 20:48225805-48225827 CAGATCTGTGGGTGGGTGGGTGG - Intergenic
1174224405 20:48985234-48985256 TTCTGGAATGGGTGGGTGGGTGG + Intronic
1174330183 20:49811929-49811951 CTCTGAAGTGTGTGGGAGGGGGG - Intergenic
1174541586 20:51293723-51293745 AGGTGGGGTGGGTGGGTGGGTGG - Intergenic
1174822219 20:53736557-53736579 TTGTTGGGTGGGTGGGTGGGTGG + Intergenic
1175299799 20:57934697-57934719 CTGGGCACGGGGTGGGTGTGTGG + Intergenic
1175317226 20:58057153-58057175 CTCAGCAGTGAGTGGGAGGGAGG - Intergenic
1175417844 20:58813242-58813264 ATGTGCAGTGGGTGAGATGGAGG - Intergenic
1175654763 20:60760533-60760555 CTCTGTAGTGGGGAGGTGGGTGG - Intergenic
1175709569 20:61208518-61208540 CTTTGCAGTGGGTTGGGGGTGGG - Intergenic
1175840270 20:62022160-62022182 CTGTGCAGTCAGGAGGTGGGTGG + Intronic
1175872233 20:62213973-62213995 CAGTGCTGGGGGTGGGTGGAGGG - Intergenic
1176022338 20:62968167-62968189 CAGGGCAGTGGGTGGGTGGCGGG + Exonic
1176070508 20:63223887-63223909 CTCTGCTGGGGGTCGGTGGGGGG - Intergenic
1176111570 20:63413346-63413368 GAGTGCAGGGGGTGTGTGGGCGG - Intronic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1176231815 20:64036762-64036784 CTGTGGCGTGTGTGGTTGGGGGG + Intronic
1176268837 20:64224874-64224896 CTGTGAAGTGGATGCTTGGGCGG + Intronic
1176276991 20:64278199-64278221 CTGGGCACTGGGTGGTTAGGTGG + Intronic
1176411959 21:6453973-6453995 CTGTGCGGTGAGTGGGTGGCGGG - Intergenic
1176511689 21:7753388-7753410 ATGTGAAGTGGATGGGTGTGAGG + Intronic
1176966691 21:15219025-15219047 CAGTGCATTGGGGGGGTGGGTGG + Intergenic
1178265752 21:31141609-31141631 CTGAGCAGAGAGTGGGTGGCAGG + Intronic
1178645803 21:34383916-34383938 ATGTGAAGTGGATGGGTGTGAGG + Intronic
1178685580 21:34708140-34708162 CTGGGCAGTGTGTGTGTGTGTGG + Intronic
1179079861 21:38160739-38160761 GTTGGCAGTGGTTGGGTGGGGGG + Intronic
1179590686 21:42405975-42405997 CTAGGCAGTGGGGGGGGGGGGGG + Intronic
1179644068 21:42764968-42764990 TTGTGGGGTGGGTGGGTGGATGG + Intronic
1179687453 21:43062295-43062317 CTGTGCGGTGAGTGGGTGGCGGG - Exonic
1180144027 21:45909791-45909813 CTGGGCAGTGGGTGGGGGGGGGG - Intronic
1180172883 21:46069568-46069590 GTGTGCATTGTGGGGGTGGGGGG + Intergenic
1180750358 22:18120029-18120051 CAGGGCAGGGTGTGGGTGGGAGG + Intronic
1180779820 22:18513728-18513750 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1180996046 22:19965811-19965833 GTGGGCATTGGGAGGGTGGGAGG + Intronic
1181198692 22:21205296-21205318 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1181356116 22:22297400-22297422 GTGGGCGGTGGGGGGGTGGGTGG - Intergenic
1181376130 22:22459707-22459729 TTGAGGAGTAGGTGGGTGGGAGG - Intergenic
1181648475 22:24246379-24246401 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1181688328 22:24544079-24544101 CTGTGCTGTGGGCGGGAGGGGGG + Exonic
1181703017 22:24631583-24631605 GACTGCAGCGGGTGGGTGGGTGG + Intergenic
1182085811 22:27560424-27560446 CTGGGCAGTGAGTGAGTGGGCGG - Intergenic
1182293950 22:29302243-29302265 GTATACAGTGGGTTGGTGGGAGG - Intergenic
1183180871 22:36258818-36258840 CTGTGGTGCGGGTGGGTGTGGGG + Intronic
1183267356 22:36836909-36836931 ATGTGCAGTTCTTGGGTGGGGGG + Intergenic
1183317605 22:37145551-37145573 CTCTGCAGGGGCTGGGTGTGCGG + Intronic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183353063 22:37344276-37344298 CTGGGCTGTGGGAGGGTTGGTGG - Intergenic
1183365273 22:37403506-37403528 CTGTGCCTTGGCTGGATGGGCGG + Intronic
1183382100 22:37495484-37495506 CTGGGCAGGTAGTGGGTGGGGGG - Intronic
1183416807 22:37687260-37687282 CTGTGGGGCGGGTGGGGGGGGGG - Intronic
1183491086 22:38115951-38115973 CAGTGCAGCGGGTGGGCTGGTGG + Intronic
1183596458 22:38815445-38815467 CGGTGGAGTGGGGGTGTGGGGGG + Intergenic
1183742957 22:39678584-39678606 CTCTGCAGGGTGGGGGTGGGAGG - Intronic
1184091402 22:42294856-42294878 CGGTGCTGTGGTTGGGTGGAGGG + Intronic
1184116867 22:42427274-42427296 CTGTGTAGTGAATGGGAGGGAGG - Intronic
1184239798 22:43206111-43206133 GTGTGTAGTGGGTGGGGGTGTGG - Intronic
1184258681 22:43302041-43302063 GTGGGCCGTGGGTGTGTGGGTGG + Intronic
1184281922 22:43442293-43442315 CTGTTCATTGGGTGGGGAGGTGG - Intronic
1184332071 22:43833546-43833568 CTTTACAGTGGGCGTGTGGGAGG - Intronic
1184347613 22:43923432-43923454 CTGTTAAGTCGGGGGGTGGGAGG - Intergenic
1184439489 22:44500190-44500212 CTGTTCAGTTGGTTGGGGGGGGG - Intergenic
1184457475 22:44619933-44619955 CTGTGGAGTGCGTGTGTGTGTGG + Intergenic
1184817790 22:46885152-46885174 CTGAGCAGCGGGTGGGAGAGTGG + Intronic
1184860087 22:47168684-47168706 CAGAACAGTGGGTGGGTGGGTGG - Intronic
1185171576 22:49297577-49297599 CTCTGCAGGGGGTGCCTGGGAGG - Intergenic
1185373124 22:50469999-50470021 CTCTGCAGGGTGTCGGTGGGAGG - Intronic
1203228113 22_KI270731v1_random:89541-89563 GACTGCAGCGGGTGGGTGGGTGG + Intergenic
949928589 3:9060769-9060791 CTGTGCAGGGCTTGGGTGGCAGG - Intronic
950442453 3:13018074-13018096 CACTTCAGTGTGTGGGTGGGTGG + Intronic
950758338 3:15196922-15196944 CTGTGCGTTGGGTGTGTGTGTGG - Intergenic
951348446 3:21575264-21575286 CTGTGCAGGGTGGAGGTGGGAGG + Intronic
951444376 3:22761273-22761295 ATGTGCAGTGGGAGCGTGGCTGG - Intergenic
951516423 3:23564989-23565011 CTTTACAGTGGGAGAGTGGGTGG + Intronic
952149897 3:30578122-30578144 CAGTTCAGTGGGTTGGGGGGTGG - Intergenic
952149938 3:30578416-30578438 CTGTATAGTGGGTTGGGGGGTGG - Intergenic
952764512 3:36943478-36943500 CTCTGCGGGGGGTGGGGGGGTGG - Intronic
953927989 3:46992079-46992101 CAGTTCAGTGGGAGGGTGTGGGG + Intronic
954222366 3:49162619-49162641 CGGTGGGGTGGGTGGGCGGGAGG - Exonic
954385570 3:50242196-50242218 CTCTGCTGTGGGTGGGGTGGGGG - Intronic
954390246 3:50264843-50264865 CTGTGATGTGGCTGGTTGGGGGG + Intergenic
954593033 3:51800529-51800551 CTGTGCTGTGGGTGTGGGTGAGG + Intergenic
954649758 3:52154003-52154025 CTTAGCAGTGGGTGGCTGCGTGG - Intronic
954756621 3:52843845-52843867 GTGTGCCTGGGGTGGGTGGGTGG + Intronic
954759311 3:52862362-52862384 TGGTGGAGTGGATGGGTGGGTGG - Intronic
954906505 3:54067706-54067728 CTGTGAAGTGGAGGGGTGGCAGG + Intergenic
955007720 3:54985231-54985253 ATGTGCAGTGTAGGGGTGGGAGG + Intronic
955007876 3:54986731-54986753 CTTGTGAGTGGGTGGGTGGGTGG - Intronic
955126014 3:56113732-56113754 ATCTGAAGTGGGAGGGTGGGGGG - Intronic
955750038 3:62178036-62178058 TTGTTGGGTGGGTGGGTGGGTGG + Intronic
955932642 3:64073040-64073062 TTGAGCAGTGGGTGGGGGAGAGG + Intergenic
956303948 3:67804138-67804160 CAGTGTACTGGGTGGGTGAGTGG + Intergenic
956451054 3:69375163-69375185 CAGGTAAGTGGGTGGGTGGGTGG - Intronic
958261463 3:91386291-91386313 GTGAGCAGTGGGTGAGTGAGTGG + Intergenic
958465615 3:94453989-94454011 CAGTTCAGTGAGTGGGAGGGAGG - Intergenic
958734088 3:97989336-97989358 GTGGTCAGTGGGTGAGTGGGTGG + Intronic
958928867 3:100187953-100187975 CTCCACAGTGGGGGGGTGGGGGG - Intronic
959083504 3:101827514-101827536 GGGTGCAGTGGGCGGGTGGAGGG - Exonic
959548047 3:107620927-107620949 CTGCGGAGTGTGTGTGTGGGGGG + Intronic
959649413 3:108737236-108737258 GAGGGGAGTGGGTGGGTGGGTGG - Intergenic
960311219 3:116118562-116118584 GTTTGCAGGGGGTGGGTGAGAGG + Intronic
960708093 3:120500735-120500757 TTGTGCAGCGGGTGGGGAGGAGG - Intergenic
961060274 3:123822808-123822830 TTGTGTATTGGGTGGGTGTGGGG - Intronic
961094484 3:124142754-124142776 TGGTGCAGGGAGTGGGTGGGGGG - Intronic
961500016 3:127325770-127325792 GTCTGCAGTCAGTGGGTGGGTGG + Intergenic
961553106 3:127680197-127680219 GTCTGCAGTGGGTGGGAAGGAGG + Intronic
961570644 3:127796091-127796113 CTGTGCAGAGAGTGGTGGGGCGG - Intronic
961674420 3:128555901-128555923 CTGTGGCGCCGGTGGGTGGGGGG - Intergenic
962346726 3:134624176-134624198 GTGTGGAGTGGGTGGGAGGTGGG - Intronic
962407254 3:135110857-135110879 CAGGGCAGTGGTGGGGTGGGGGG + Intronic
962741818 3:138367548-138367570 CTAGGAAGTGGGTGGCTGGGTGG - Intronic
962820996 3:139047228-139047250 CTGTCCAGTGGTTGCGTGGTGGG + Intronic
962858235 3:139370045-139370067 CTGGGGAATGGGTGGATGGGGGG + Intronic
963043066 3:141083351-141083373 CTCTACAGAGGGTGGGGGGGTGG - Intronic
963085715 3:141434386-141434408 GTGTGCACTGGGGGGGCGGGGGG + Intronic
963602435 3:147390174-147390196 TTCAGCAGGGGGTGGGTGGGTGG - Intronic
964733134 3:159888712-159888734 AATTGCAGTGGGTGGGTGAGTGG + Intronic
964809913 3:160652441-160652463 ATATGAATTGGGTGGGTGGGGGG - Intergenic
966862920 3:184240738-184240760 CTCTGTAGAGGGTGGGTGGTGGG + Intronic
966923121 3:184627356-184627378 GTCTGCAGTGTGGGGGTGGGGGG + Intronic
967155315 3:186686269-186686291 TAGTGCAGAGAGTGGGTGGGTGG + Intergenic
967889160 3:194352732-194352754 GTGTGCAGTGAGTGGGTGTGTGG + Intergenic
967889167 3:194352782-194352804 GTGTGCAGTGTGTGGGTGTGTGG + Intergenic
967981310 3:195066801-195066823 CTGTGCACTGGGGGGTTGGAAGG + Intergenic
968048500 3:195637204-195637226 CTGCGCTGTGGGTGGTGGGGGGG + Intergenic
968190168 3:196661437-196661459 CTGTGGGGTGGATGGCTGGGGGG + Exonic
968194445 3:196695027-196695049 GTGTGTAGTGTGTGGGTGTGCGG - Intronic
968410591 4:386595-386617 GTGCGCAGTGGGCGCGTGGGAGG + Intergenic
968449265 4:667482-667504 GTGTGCCGTGTGTGTGTGGGAGG + Intronic
968655394 4:1776394-1776416 CTGAGCAGGTGGTGGCTGGGAGG - Intergenic
968909997 4:3472818-3472840 CTGGGCAGTGGCCGGGTGGATGG + Intronic
968957481 4:3726706-3726728 CAGGGCAGTGGGGCGGTGGGTGG - Intergenic
969200497 4:5600812-5600834 CTGAGCAAAGGATGGGTGGGGGG - Intronic
969255142 4:5996307-5996329 CTGAGCAGTGCGTGGAAGGGAGG - Intergenic
969310052 4:6347795-6347817 CTGTGCATTGGGCAGGCGGGCGG - Intronic
969365949 4:6694363-6694385 CTGTGCAGTGGGGGCAGGGGCGG + Intronic
969665941 4:8557725-8557747 CTGAGCGGAGGGTGTGTGGGAGG - Intergenic
970191659 4:13523930-13523952 CGGTGGAGTGGGTGGGTGAGGGG - Intergenic
970852928 4:20623442-20623464 CAGAGCAGAGGGTGGGTTGGAGG - Intergenic
971509542 4:27407082-27407104 ATGTGCAGTGGATGGTTGGGTGG + Intergenic
972265443 4:37454557-37454579 CTGGGCAGTGGGTAGGGGTGGGG + Intronic
972302088 4:37794009-37794031 GTGAGCAGTGGGTGGTTGGGTGG - Intergenic
972323110 4:37991052-37991074 CTGGGGCGGGGGTGGGTGGGGGG + Intronic
973297340 4:48539517-48539539 CGGGGCAGGGGGAGGGTGGGGGG - Intronic
974339465 4:60596344-60596366 CTGTGATGTGGTTGGGTGGTAGG - Intergenic
976733636 4:88288387-88288409 CAGGGCTTTGGGTGGGTGGGTGG + Intergenic
977471770 4:97452126-97452148 CTGTGCTGGGGGCGGGGGGGGGG - Intronic
978230478 4:106391857-106391879 ATGGGAGGTGGGTGGGTGGGAGG - Intergenic
978807804 4:112818700-112818722 CTCTGCATTGGGTGAGTAGGTGG + Intronic
979473824 4:121131628-121131650 GTGTGGAGTGGGTGGGTAGGGGG + Intronic
979610656 4:122685557-122685579 AAAGGCAGTGGGTGGGTGGGTGG + Intergenic
979768926 4:124498387-124498409 TGGTGAAGTGGGTGGGTGGATGG + Intergenic
980572594 4:134639978-134640000 TTTGGCAGGGGGTGGGTGGGGGG + Intergenic
980791273 4:137622529-137622551 TTGTTGGGTGGGTGGGTGGGTGG - Intergenic
980816702 4:137956547-137956569 CTTTGCTGTGTGTGTGTGGGGGG + Intergenic
980883280 4:138735564-138735586 CTGTGCAGAGGCTGGGAAGGTGG - Intergenic
982202674 4:152975123-152975145 CTGTGCTGAGGGTGGGTTGGGGG - Exonic
982895169 4:160911446-160911468 GTCTGCAGTGGGGTGGTGGGGGG + Intergenic
983389940 4:167117505-167117527 CTGTGTACTACGTGGGTGGGGGG - Intronic
984105395 4:175539217-175539239 CTGAGCAGTTGGGGTGTGGGGGG + Intergenic
984843914 4:184093912-184093934 CCTTGCTGTGTGTGGGTGGGAGG + Intronic
985070228 4:186160242-186160264 GTGTGCAGTGTGTGTGTGAGTGG - Intronic
985070241 4:186160384-186160406 GTGTGCAGTGTGTGTGTGAGTGG - Intronic
985181546 4:187270128-187270150 CTCTGCACTGTGTGTGTGGGGGG - Intergenic
985520645 5:372659-372681 CGGTGCAGACGGAGGGTGGGAGG - Intronic
985646045 5:1085193-1085215 CTGAGCCGTGGGTGGGTGTGGGG - Intronic
985672599 5:1214059-1214081 CTGTGCAGTGAGTGCGGGTGTGG + Exonic
985817421 5:2137082-2137104 CTGGGCATTGCGTGCGTGGGTGG + Intergenic
985837281 5:2280640-2280662 ATGGGCAGGGGATGGGTGGGCGG + Intergenic
985905441 5:2831507-2831529 GTGTGCGGTGGGTGGGAGGGAGG + Intergenic
986009219 5:3697065-3697087 AGGTGCAGCGGGCGGGTGGGGGG + Intergenic
986063285 5:4212031-4212053 CTATGGGGTGGGGGGGTGGGGGG - Intergenic
986224655 5:5801502-5801524 CTGTGCAGTGGGATGGAGGCTGG + Intergenic
986344340 5:6820417-6820439 TTGTGGGGTGAGTGGGTGGGGGG + Intergenic
986974925 5:13382933-13382955 CTGTGTGGTGGGGGGGTGAGAGG - Intergenic
987331746 5:16863279-16863301 CTCCCCAGTGGGTGGGTGGATGG - Intronic
987921129 5:24283301-24283323 GTGTGGTGTGTGTGGGTGGGTGG - Intergenic
988449033 5:31321162-31321184 CTAGGCACTGAGTGGGTGGGTGG - Intronic
989174538 5:38510373-38510395 TTCTGGAGTGGGGGGGTGGGAGG - Intronic
989204325 5:38796557-38796579 CTGAGCTGAGGGTGGGTGGGTGG + Intergenic
989251297 5:39319047-39319069 CTGTGCTATGGGAGGGTTGGGGG - Intronic
989850234 5:46199275-46199297 TTGTGGAGTGGGGGGGAGGGGGG + Intergenic
990207717 5:53448005-53448027 CTTTACAGAGGGTGGGTGGATGG + Intergenic
991013299 5:61906358-61906380 ATGTGCAGGAGGTGGGTTGGTGG - Intergenic
992265688 5:75016142-75016164 GTGGGGGGTGGGTGGGTGGGTGG + Intergenic
992413648 5:76532470-76532492 CTGAGGATTGGGTGGGTGGGGGG + Intronic
992950413 5:81852297-81852319 CTGTGGGGTGGGCGGGGGGGTGG + Intergenic
993022860 5:82612582-82612604 GTGTGTAGGGGGTGGGAGGGTGG + Intergenic
993401788 5:87462355-87462377 CTGTGAAGTGGGTGGGTGTGGGG - Intergenic
993447163 5:88027521-88027543 CAGGGCAGTGGTTAGGTGGGTGG - Intergenic
993625087 5:90214205-90214227 TTGTGGGGTGGGTGGGGGGGGGG + Intergenic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
994640068 5:102396652-102396674 GTGTGTAGGGGGTGGGTGAGTGG + Intronic
995525742 5:113049360-113049382 CTGCCAAGTGGGTGGGTGGGGGG + Intronic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
996488546 5:124065500-124065522 CTGTGAAGTGGGTGGGTTATTGG + Intergenic
997675101 5:135707011-135707033 GTGTGCAGTGAGTGGATGAGTGG + Intergenic
998133078 5:139660862-139660884 CCAGCCAGTGGGTGGGTGGGTGG - Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
998494137 5:142572376-142572398 GTGTGGTGTGGGGGGGTGGGAGG + Intergenic
998786216 5:145711722-145711744 CTGTGTGTTGGGTGGGTTGGGGG + Intronic
998806498 5:145922172-145922194 CTGGGCAGAGGGTGTGTGGCAGG - Intergenic
999130313 5:149278049-149278071 CTTGGCAGAGGGTGGGAGGGAGG - Intronic
999305361 5:150515958-150515980 CTGGGGTGGGGGTGGGTGGGGGG - Intronic
999980805 5:156956131-156956153 CTGGGGGGTGGGTGAGTGGGTGG - Intronic
1000214875 5:159145772-159145794 TAGTGAACTGGGTGGGTGGGAGG + Intergenic
1000280857 5:159780728-159780750 CTGTGCAGTGTGTGGGTAGGAGG - Intergenic
1000463175 5:161547214-161547236 TTGTGCAGCGGGTGGGAGGAGGG + Intronic
1001012669 5:168112594-168112616 GTGTGCAGTGGGCGGGGGGGGGG + Intronic
1001538261 5:172515241-172515263 GTGTGTTCTGGGTGGGTGGGGGG - Intergenic
1001541464 5:172542751-172542773 CTTTGCAGTGGGATGGTGAGTGG + Intergenic
1001689928 5:173625453-173625475 CTGGATAGTGAGTGGGTGGGAGG - Intergenic
1001961830 5:175884286-175884308 GTGTGCGGGGGGTGGGGGGGTGG - Intergenic
1002073545 5:176694895-176694917 CAGAGCAGTGGGCTGGTGGGTGG + Intergenic
1002495316 5:179607673-179607695 CAGGGCACTGGGAGGGTGGGTGG - Intronic
1002723801 5:181281881-181281903 CTGAGCCGTAGGAGGGTGGGTGG + Intergenic
1003115567 6:3281647-3281669 CTGTGAAGTGGGGGGATGGTAGG + Intronic
1003465570 6:6376860-6376882 CTGGGCAGCGGCGGGGTGGGTGG - Intergenic
1004397284 6:15256580-15256602 GTGTGAAGTGGATGGGTGGCAGG - Intronic
1004494920 6:16154545-16154567 CAGTGCTGTGGGTGGGTTGGGGG - Intergenic
1004914675 6:20320538-20320560 CTGAGGAGTGGGGGGGTGCGTGG + Intergenic
1005136721 6:22577294-22577316 ATGTGCTGAGGGTGGGTGTGTGG - Intergenic
1005972067 6:30769342-30769364 GTGTGCAGTGGGCGCGGGGGTGG - Intergenic
1006272316 6:32973703-32973725 TTGTGTAGTGGGTGGGTGGAAGG + Intronic
1007231381 6:40349619-40349641 CAGTGGTGTGAGTGGGTGGGTGG + Intergenic
1007277911 6:40689146-40689168 CTGTGCTGTGGGGGGTGGGGAGG + Intergenic
1007282213 6:40721003-40721025 CTGAGCAGTGGCTGGCAGGGTGG - Intergenic
1007359506 6:41345016-41345038 GTGTGCAGTGGGGGCCTGGGTGG - Intronic
1008638158 6:53433010-53433032 CAGTTCACAGGGTGGGTGGGTGG - Intergenic
1008906656 6:56684985-56685007 GTGTGGGGTGGGGGGGTGGGTGG - Intronic
1008993698 6:57633856-57633878 GTGAGCAGTGGGTGAGTGAGTGG - Intronic
1009182305 6:60532941-60532963 GTGAGCAGTGGGTGAGTGAGTGG - Intergenic
1009863338 6:69364332-69364354 GAGTGCAGAGGGTGAGTGGGTGG + Intronic
1009869770 6:69439685-69439707 TTGTGGGGTGGGTGGGAGGGGGG - Intergenic
1011130098 6:84043664-84043686 GTGTGGGGTGAGTGGGTGGGTGG + Intronic
1011241806 6:85279681-85279703 ATGTGTGGGGGGTGGGTGGGTGG - Intergenic
1012149550 6:95730076-95730098 CTTTACATTTGGTGGGTGGGGGG + Intergenic
1012546364 6:100424062-100424084 CTGGGCGGGGGGTGGGAGGGGGG - Intronic
1013313780 6:108922164-108922186 TACTGCAGTGGGTGGGTGCGAGG - Intronic
1013471745 6:110472382-110472404 CAGTGCAGAGGGTGGATTGGAGG - Intronic
1013638246 6:112048941-112048963 CAGTGGTGTGGGTGGGTGGGTGG - Intergenic
1015612912 6:135045048-135045070 ATTTGCAAAGGGTGGGTGGGGGG + Intronic
1015936888 6:138413578-138413600 TTGTGCAGTGGGGCAGTGGGAGG - Exonic
1016233205 6:141831114-141831136 CTGTGCACTGGGAGGATGGGAGG - Intergenic
1017992230 6:159501065-159501087 GTGTGAAGTGGGGTGGTGGGTGG - Intergenic
1018239709 6:161761312-161761334 GTGTGCAGTGGATGGATGGATGG + Intronic
1018645465 6:165943899-165943921 CTGTGCAGCCGGTTGGTGGCAGG - Intronic
1018677558 6:166236113-166236135 GTGGGCAGGGGGTGGGGGGGGGG - Intergenic
1018971192 6:168530649-168530671 CAGAGCAGTGGGTGTGGGGGCGG - Intronic
1019163754 6:170085942-170085964 CGGTGCAGTGGGTGGGACTGAGG - Intergenic
1019443021 7:1056849-1056871 CTGTGCTTTGGCGGGGTGGGGGG + Intronic
1019476654 7:1247645-1247667 CTGTGCTGGGGGCGGGAGGGAGG - Intergenic
1019487232 7:1294930-1294952 CTGTGGTGTGGGTGCATGGGTGG + Intergenic
1019487269 7:1295109-1295131 GTGTGGTGTGGGTGTGTGGGTGG + Intergenic
1019487280 7:1295173-1295195 GTGTGGTGTGGGTGTGTGGGTGG + Intergenic
1019487346 7:1295483-1295505 GTGTGGTGTGGGTGTGTGGGTGG + Intergenic
1019497763 7:1348346-1348368 CATTGCAGTGGGTTGGTGGGTGG - Intergenic
1019525473 7:1478616-1478638 CTGGGCAGTGGCTTGGGGGGTGG - Intronic
1019563714 7:1669871-1669893 AGGTGGAGGGGGTGGGTGGGTGG - Intergenic
1019587278 7:1812489-1812511 AGGTGCAGTGGGAGGGAGGGAGG + Intergenic
1019641517 7:2106132-2106154 CTGTGCTGGGGGTGGGAGGCGGG - Intronic
1019704678 7:2491840-2491862 CTGATGTGTGGGTGGGTGGGTGG - Intergenic
1019704838 7:2492651-2492673 CTGATGTGTGGGTGGGTGGGTGG - Intergenic
1020091677 7:5345520-5345542 CTGCGGTGGGGGTGGGTGGGAGG - Intronic
1020138380 7:5599000-5599022 CTGTGCAGTGGGGGTGGGGCGGG + Intronic
1020192613 7:6011738-6011760 CTGTGCAGTTGGAGGGTGACTGG - Intronic
1020803064 7:12756046-12756068 ATGGGGAGTGGGTGGGTGGGAGG + Intergenic
1021242657 7:18223446-18223468 CTGTTCATTGGGTTGCTGGGAGG - Intronic
1022378718 7:29840139-29840161 TACTGCAGTGGGTGGGTGGTGGG - Intronic
1022392333 7:29954214-29954236 CTGTGTAGTGGCTGGGAGAGGGG + Intronic
1022585330 7:31603396-31603418 CTGTGGAGTGGGTGGGGAGGGGG - Intronic
1023348575 7:39296584-39296606 CTGTGCAGTGGGAGGGAGTCAGG - Intronic
1023713022 7:43014634-43014656 CTGTGCAATGGAAGGGTAGGTGG + Intergenic
1023834285 7:44059289-44059311 CTGTGGGGTGCGTGGGTGTGTGG + Intronic
1023873827 7:44276427-44276449 TTGTGCAGTGGGTGGCGGGGGGG - Intronic
1023912532 7:44566131-44566153 CAGTTGGGTGGGTGGGTGGGTGG - Intronic
1024242499 7:47446508-47446530 CTGGGCAGAGGCTGGGTGGGAGG - Intronic
1024426632 7:49233273-49233295 CTGTGCACTTGGTGGTGGGGAGG + Intergenic
1025055576 7:55762057-55762079 CAGGGCATTGGGAGGGTGGGAGG - Intergenic
1025910386 7:65824094-65824116 CAGGGCATTGGGAGGGTGGGAGG + Intergenic
1026103787 7:67404609-67404631 CTGGTGAGTGGGTGGGTGGGTGG + Intergenic
1026669876 7:72380652-72380674 CTGCTCAGTGGGTTGGTGGATGG + Intronic
1026742980 7:72990441-72990463 CTGTGCTGGGGGTGGGATGGGGG + Intergenic
1026802285 7:73407904-73407926 GTGGGCAGTGGGGGGGTTGGCGG + Intergenic
1026802832 7:73410826-73410848 CTGTGCAGGGGGTGGGATGGGGG + Intergenic
1027029095 7:74875145-74875167 CTGTGCAGGGGGTGGGATGGGGG + Intergenic
1027100755 7:75374637-75374659 CTGTGCAGGGGGTGGGATGGGGG - Intergenic
1028007549 7:85593893-85593915 CAGTGAAGTGGGGGGGCGGGGGG + Intergenic
1028216381 7:88138949-88138971 CTCTGCAGTGGGCAGGAGGGTGG + Intronic
1029250363 7:99232239-99232261 CTGTAAAGTGGGTGGCTGGGTGG - Intergenic
1030335818 7:108324628-108324650 CTGTCCAGTCGGGGGCTGGGTGG + Intronic
1030369906 7:108687082-108687104 GTGTGTGGTGGGTAGGTGGGAGG + Intergenic
1030457016 7:109788191-109788213 TAGTGCGGTGTGTGGGTGGGTGG + Intergenic
1031664944 7:124472413-124472435 CAGGGCAGAGGGTGGGTGGTAGG + Intergenic
1033358321 7:140619364-140619386 GTTAGGAGTGGGTGGGTGGGAGG + Intronic
1033570944 7:142627540-142627562 GTGTGCAGGGGGTGGGGCGGGGG + Intergenic
1033943235 7:146681500-146681522 GTGGGGAGTGGGAGGGTGGGAGG + Intronic
1034210781 7:149360203-149360225 TGGGGCAGTGGGTGGGTGGGTGG - Intergenic
1034423149 7:150999595-150999617 GTGTGCAGTGGGTGAGAGTGTGG + Intronic
1034606222 7:152318432-152318454 ATGGGGAGGGGGTGGGTGGGTGG - Intronic
1035055140 7:156030198-156030220 CAGGGCAGGGGTTGGGTGGGTGG + Intergenic
1035165455 7:156986915-156986937 TTGTGCAGTGAATGTGTGGGTGG + Intergenic
1035243144 7:157545155-157545177 GTGTGCAGTGTGTGGCTGAGTGG + Intronic
1035317853 7:158007935-158007957 CTGTGCTGTGTGTGGGGGTGTGG + Intronic
1035440237 7:158891173-158891195 CTCCGCAGTGGTGGGGTGGGGGG + Intronic
1036082117 8:5568275-5568297 CTCAGCAGAGGGTGGGTGCGAGG + Intergenic
1036633206 8:10529828-10529850 CTGGGGGGTGGGTGGATGGGTGG - Intronic
1037149312 8:15616670-15616692 CTGTGCTGTGGGTGGCAGGAAGG + Intronic
1037283516 8:17270950-17270972 TTGTACAGTGGGTGTGTGAGGGG - Intronic
1037764934 8:21766806-21766828 GTGTGGAGCGTGTGGGTGGGCGG - Intronic
1037837405 8:22222226-22222248 GTGTGCAGGGGGTGGGTAAGTGG - Intronic
1038190421 8:25314769-25314791 TTGTGCAGTGGATGGATAGGTGG - Intronic
1038278699 8:26143287-26143309 CTGGGCAGGGGGTGGCTGTGGGG - Intergenic
1039228740 8:35419611-35419633 CAGCGCAGTGGATGGGAGGGAGG + Intronic
1039453766 8:37695428-37695450 CTCACCACTGGGTGGGTGGGGGG - Intergenic
1039573444 8:38604909-38604931 TCTTGAAGTGGGTGGGTGGGGGG - Intergenic
1039575797 8:38623098-38623120 GTGTGCACTGGATGGGTGGCTGG + Intergenic
1040470269 8:47730777-47730799 AGGTGCAGTGGGTGAGAGGGTGG - Intronic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1041714822 8:60923341-60923363 CTGGGCGGTGGGGGGGGGGGGGG + Intergenic
1041889181 8:62849598-62849620 TTGTGGGGTGGGTGGGGGGGAGG - Intronic
1042527366 8:69777496-69777518 CTGGGGTGTGTGTGGGTGGGGGG + Intronic
1042563091 8:70088189-70088211 GCGTGCAGTGCGGGGGTGGGGGG - Intergenic
1042953019 8:74220547-74220569 ATGTTAAGGGGGTGGGTGGGAGG - Intergenic
1043401541 8:79890090-79890112 TGGGGCTGTGGGTGGGTGGGAGG + Intergenic
1043623581 8:82227856-82227878 TGGTACACTGGGTGGGTGGGTGG - Intergenic
1043709915 8:83403219-83403241 CCATGGAGTGGGTGGGTGGGAGG - Intergenic
1043858190 8:85286013-85286035 CTGTGCAATGTGTGGGTGAAAGG - Intergenic
1045370243 8:101515626-101515648 CAGTGCAGAGGTTGGATGGGGGG + Intronic
1046346323 8:112932673-112932695 GTGTGCAGTGTGTGTGTGCGTGG + Intronic
1046687362 8:117242508-117242530 TTGTGGGATGGGTGGGTGGGAGG - Intergenic
1046953088 8:120036462-120036484 CTGTGGAGTGACTGTGTGGGAGG - Intronic
1047180718 8:122585171-122585193 CTGTGGGGTGGGGGGGTGGGGGG - Intergenic
1047286953 8:123495633-123495655 CTGTGGACTGGGCGGGTGCGGGG + Intergenic
1047663018 8:127059128-127059150 CTGTACAGAGGGTGGGTGACTGG - Intergenic
1049000684 8:139823891-139823913 CTGTGCCAAGGGTGGGTGAGAGG - Intronic
1049161096 8:141098452-141098474 CTGTAAAGTGGGTGGGGTGGGGG - Intergenic
1049179137 8:141212148-141212170 CATTCCAGTGGGCGGGTGGGCGG - Intronic
1049223146 8:141436953-141436975 ATCTGCACTGGGTGGGGGGGTGG + Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049376639 8:142292474-142292496 CTGTGGAGGTGGTGGGTGGCGGG + Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049386479 8:142345401-142345423 TTGTGCAGTGGGCCGGTGAGGGG - Intronic
1049404325 8:142444948-142444970 CTGAGCTGGGGGTGGGAGGGGGG + Intergenic
1049426828 8:142541505-142541527 CTGGGCCTTGTGTGGGTGGGGGG - Intronic
1049436269 8:142587548-142587570 CTGTGGAGTGGGAGGGAGTGGGG + Intergenic
1049436288 8:142587597-142587619 CTGTGGAGTGGGAGGGAGTGGGG + Intergenic
1049464617 8:142745079-142745101 ATGGGCAGAGGATGGGTGGGTGG + Intergenic
1049472715 8:142783486-142783508 CCCTGCAGTGGCTGGGAGGGGGG + Intergenic
1049575753 8:143388899-143388921 CTGTGCTGCGGGTGGGGAGGAGG + Intergenic
1049583301 8:143422263-143422285 CTGAGGACTGGGTGGGAGGGAGG + Intronic
1049592181 8:143467767-143467789 CTGGGCAGAGGGCGGGAGGGAGG - Intronic
1049803437 8:144528619-144528641 CGTTCCAGGGGGTGGGTGGGTGG - Intronic
1049846201 8:144803035-144803057 CTGTGATGTGGGTGGGTGTGAGG - Intronic
1050230805 9:3524972-3524994 GTGTGCAAGGGGTGTGTGGGGGG + Intronic
1050552139 9:6758004-6758026 CCGTCGAGGGGGTGGGTGGGAGG - Intronic
1052214759 9:25952086-25952108 CTCTGCAGGGGGTGGGTAAGGGG + Intergenic
1052336703 9:27327550-27327572 ATGTGCAGTGTGTGTGTGTGTGG - Exonic
1052408497 9:28092543-28092565 TTGTGCGGTGGGGGGGAGGGGGG + Intronic
1052824363 9:33164310-33164332 CTTGGGAGTGTGTGGGTGGGGGG - Intronic
1054365542 9:64335467-64335489 CTCTGAAGTGGGTGAGTTGGAGG + Intergenic
1055030617 9:71768889-71768911 CTGTGGATTGGGCGGGCGGGCGG + Intronic
1055154139 9:73039850-73039872 CTGAGTAGTGAGTAGGTGGGAGG - Intronic
1055336928 9:75241686-75241708 CTATGAAGTGGGGGTGTGGGAGG - Intergenic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1056922990 9:90808589-90808611 CTGTGTGGTGTGTGGGTGGCAGG + Intronic
1057052242 9:91934470-91934492 GTGTGCTTTGGGTGTGTGGGTGG - Intronic
1057519705 9:95751534-95751556 CTGAGCTGTGGGAGGGAGGGAGG + Intergenic
1058587465 9:106525609-106525631 CTCAGAAGGGGGTGGGTGGGAGG + Intergenic
1058857375 9:109076377-109076399 CTGTGGGGTGGGGGGGAGGGGGG + Intronic
1058971365 9:110086158-110086180 CTGAGAAGTGGGAGGGTGTGGGG + Intronic
1059498585 9:114731113-114731135 GTGGGGGGTGGGTGGGTGGGTGG - Intergenic
1060231720 9:121830409-121830431 CTGTGCAGTGGGGAGCAGGGAGG - Intronic
1060401802 9:123353928-123353950 CAGTGCTGCTGGTGGGTGGGGGG + Intergenic
1060404674 9:123367432-123367454 GTGTGGGGTGGGGGGGTGGGGGG - Intronic
1060826615 9:126691639-126691661 CTGGGCTGCGGGTTGGTGGGGGG - Intronic
1060896048 9:127218305-127218327 GTGTGCAGAGGGTGGGTGGCTGG - Intronic
1061478252 9:130883609-130883631 GAGTGATGTGGGTGGGTGGGGGG - Intronic
1061590321 9:131593776-131593798 CAGTGAACTGGGTGGGTGTGGGG - Intronic
1061608410 9:131729341-131729363 GTGTTGGGTGGGTGGGTGGGTGG + Intronic
1061905694 9:133695726-133695748 CTGTTGGGTGGGTGGGTGGGTGG + Intronic
1062020680 9:134318056-134318078 CTGTGAGCTGGCTGGGTGGGGGG - Intronic
1062020690 9:134318091-134318113 CTGTGAGCTGGCTGGGTGGGGGG - Intronic
1062024163 9:134332745-134332767 CTGTGCAGAGGGTGGTCTGGAGG + Intronic
1062049128 9:134438133-134438155 CTGAACAGAGGGTGGATGGGGGG + Intronic
1062105272 9:134751656-134751678 CCGTGGGGCGGGTGGGTGGGTGG + Intronic
1062246864 9:135573483-135573505 ATATGCAGTGGATGGATGGGTGG - Intergenic
1062284850 9:135768331-135768353 CTGTGATGTGGGTTGGGGGGGGG + Intronic
1062478749 9:136742021-136742043 CTGCGCAGCGGATGTGTGGGCGG + Intronic
1062514950 9:136928389-136928411 GTGGGAAGTGGGTTGGTGGGTGG + Intronic
1062540518 9:137039885-137039907 CTGGGCAGTGGGTGGGCTGGGGG + Intronic
1062649920 9:137570129-137570151 ATGGGTGGTGGGTGGGTGGGTGG - Intronic
1203636740 Un_KI270750v1:119804-119826 CTGTGCTGTGTGTGTCTGGGTGG + Intergenic
1186194879 X:7100051-7100073 TTATGCTGTTGGTGGGTGGGTGG - Intronic
1186357213 X:8800903-8800925 GTGTGCAGTGGGTAGGGGTGGGG - Intronic
1186507439 X:10104199-10104221 GAGTGGGGTGGGTGGGTGGGTGG + Intronic
1186601622 X:11043926-11043948 AAGGGTAGTGGGTGGGTGGGTGG - Intergenic
1186752742 X:12638601-12638623 AGGTGTGGTGGGTGGGTGGGTGG - Intronic
1186942790 X:14529253-14529275 CTAGGCTGTCGGTGGGTGGGCGG - Intergenic
1187149636 X:16669767-16669789 CTGTGCAGTGGATGGCTGGGTGG - Intronic
1187203569 X:17159639-17159661 ATGTGCATTGGGGGGCTGGGGGG - Intergenic
1187478173 X:19630221-19630243 CTTTGCAGTGGGAGGGAGCGGGG - Intronic
1187950596 X:24466224-24466246 CTGTCCGGTGGGCTGGTGGGCGG + Intronic
1188196691 X:27243196-27243218 CTAGGCTGAGGGTGGGTGGGAGG - Intergenic
1189231162 X:39453534-39453556 CTCTCCAATGGGCGGGTGGGGGG - Intergenic
1189231601 X:39456184-39456206 CGGGGCAGCGGGTGGGTGGGGGG + Intergenic
1189745413 X:44163315-44163337 TTAAGAAGTGGGTGGGTGGGTGG - Intronic
1189865335 X:45321691-45321713 CTGCTGAGTGGCTGGGTGGGTGG + Intergenic
1190109131 X:47578693-47578715 CTGTGCTGTGGGGGTGGGGGTGG - Intronic
1190116156 X:47627328-47627350 GTGTGCTGTGGTGGGGTGGGAGG + Exonic
1192151048 X:68712624-68712646 CTGGGCAGGGGGTGGGAGAGTGG + Intronic
1192486380 X:71530533-71530555 CTGGTGGGTGGGTGGGTGGGTGG + Intronic
1193348198 X:80428920-80428942 TTGTGCAGTGGGAGGAAGGGAGG + Intronic
1193843347 X:86437430-86437452 AGGTTCAGTGGGTGGGTAGGAGG - Intronic
1194650898 X:96512701-96512723 CTGTGCAGTGGGGGGCTGAAGGG + Intergenic
1194998896 X:100622777-100622799 CTGGGCAGTGGGAGTGAGGGTGG + Intergenic
1195365651 X:104122835-104122857 CTGTGGAGAGGTTGGGTGGTTGG + Intronic
1196029958 X:111086110-111086132 CTGGGCAGGGGGGCGGTGGGGGG + Intronic
1196766744 X:119252891-119252913 CTTGGCAGTGGGAGGGAGGGAGG - Intergenic
1196812533 X:119640144-119640166 CTGGATAGTGGGAGGGTGGGAGG - Intronic
1196859317 X:120012683-120012705 CAGTACAGTGGGGGTGTGGGGGG - Intergenic
1196896453 X:120341486-120341508 CCGTGAAGTGGGTGGGTCGGGGG + Intergenic
1196937312 X:120742673-120742695 CTGAACAGTGTGTGGGGGGGTGG + Intergenic
1197689084 X:129477783-129477805 CAGGGAGGTGGGTGGGTGGGTGG - Intronic
1197903783 X:131401449-131401471 GTGTGTAGGGGGTGTGTGGGAGG - Intergenic
1198098204 X:133400903-133400925 GTCTGCAGGGGGTGGGGGGGTGG + Intronic
1198214233 X:134542600-134542622 CTGAGCAGTTGGTGGGTGTTTGG - Intergenic
1198369153 X:135974153-135974175 GGGGCCAGTGGGTGGGTGGGTGG + Intergenic
1198567157 X:137916387-137916409 CAGGGCAGTGGGGGGATGGGGGG + Intergenic
1199601507 X:149543962-149543984 CAGTGGAGTGGGTGGTGGGGGGG + Intronic
1199648870 X:149935522-149935544 CAGTGGAGTGGGTGGTGGGGGGG - Intronic
1199683082 X:150240843-150240865 CTGTGCACATGGTGGGAGGGAGG + Intergenic
1199739425 X:150719223-150719245 TTGTGCCATGGGTGGATGGGAGG + Intronic
1199754707 X:150853391-150853413 CAGTGAAGTGGGTGGGTGGGGGG - Intronic
1200043797 X:153388833-153388855 CGGTGGACAGGGTGGGTGGGTGG + Intergenic
1200279252 X:154762847-154762869 CAGGGCAGTGCGCGGGTGGGTGG + Exonic
1201789638 Y:17825408-17825430 GTGTGGAGCGGGTGGGGGGGGGG - Intergenic
1201811916 Y:18080581-18080603 GTGTGGAGCGGGTGGGGGGGGGG + Intergenic
1202088516 Y:21163845-21163867 CTGTGCTCTGTGTTGGTGGGAGG - Intergenic
1202351289 Y:23995158-23995180 GTGTGGAGCGGGTGGGGGGGGGG - Intergenic
1202367946 Y:24179652-24179674 CTGAACTGTGGGTGGATGGGTGG - Intergenic
1202502837 Y:25490465-25490487 CTGAACTGTGGGTGGATGGGTGG + Intergenic
1202519490 Y:25674961-25674983 GTGTGGAGCGGGTGGGGGGGGGG + Intergenic