ID: 907460406

View in Genome Browser
Species Human (GRCh38)
Location 1:54602176-54602198
Sequence GGCCAGGATCAGCACCCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907460406_907460419 29 Left 907460406 1:54602176-54602198 CCATTGGGGTGCTGATCCTGGCC No data
Right 907460419 1:54602228-54602250 CCCTCACCCTTCCTTGTCTCAGG No data
907460406_907460411 2 Left 907460406 1:54602176-54602198 CCATTGGGGTGCTGATCCTGGCC No data
Right 907460411 1:54602201-54602223 GGCCCTTACCCCTGTGGCCTTGG 0: 1
1: 0
2: 2
3: 14
4: 232
907460406_907460409 -4 Left 907460406 1:54602176-54602198 CCATTGGGGTGCTGATCCTGGCC No data
Right 907460409 1:54602195-54602217 GGCCTCGGCCCTTACCCCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907460406 Original CRISPR GGCCAGGATCAGCACCCCAA TGG (reversed) Intronic