ID: 907466438

View in Genome Browser
Species Human (GRCh38)
Location 1:54640882-54640904
Sequence CTGAAGCAGCAGAAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 606}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907466435_907466438 -4 Left 907466435 1:54640863-54640885 CCTCGATGACACAAGGCCTCTGA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG 0: 1
1: 0
2: 3
3: 59
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907466438 Original CRISPR CTGAAGCAGCAGAAGGAGAC TGG Intergenic
900467026 1:2830868-2830890 ATGAAGCAGCAGCAGGCGGCGGG - Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903559759 1:24218465-24218487 CTGAGGGAGCAGCAGTAGACAGG - Intergenic
903689732 1:25164250-25164272 CTCCAGGAGCAGAAGGAGCCTGG - Intergenic
904432414 1:30472976-30472998 CTGAAGGAGCAGAAAGGGAAGGG - Intergenic
904603239 1:31684813-31684835 CTGAAGGGGCAGAAGGTGAGAGG - Exonic
904784930 1:32975739-32975761 CTGAGGCAGGAGAATCAGACCGG + Intergenic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905036931 1:34924767-34924789 CTGAAACAGCAAAAGGGGAGAGG + Intronic
905477372 1:38238523-38238545 CTGAAGGAAATGAAGGAGACAGG - Intergenic
905605349 1:39293657-39293679 TAACAGCAGCAGAAGGAGACAGG + Intronic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
905702217 1:40026115-40026137 AAGAAGCAGCAGGAGTAGACAGG + Intergenic
906014133 1:42558671-42558693 TTGGAGTACCAGAAGGAGACGGG + Intronic
906129361 1:43446929-43446951 GGGAGGCAGCAGCAGGAGACAGG - Intronic
906577340 1:46902678-46902700 CAGAAGAAGCAGAAGTACACTGG - Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907935571 1:59039107-59039129 CTGAGGCAGCACCAGGAGGCAGG - Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
909332981 1:74437226-74437248 CTGAAGCAGCAGGAAGTGAGAGG - Intronic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910766512 1:90787961-90787983 ATGAACAAGCAGAGGGAGACAGG - Intergenic
910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG + Intergenic
911122233 1:94308321-94308343 CTGAAGCAGCGGATGGGGAAGGG - Intergenic
911371235 1:96997155-96997177 CAAAAGTAGCAGAAGGAGAAAGG - Intergenic
912145325 1:106786686-106786708 TAGCAGCAGCAGAAGGACACGGG - Intergenic
913022951 1:114805230-114805252 CTGATGCAGGAGAAGCAGGCAGG + Intergenic
913169963 1:116222778-116222800 CTGAGGCTGCAGAAGGACACTGG + Intergenic
913196095 1:116457476-116457498 ATGAAGCAGCAGCAGGTGGCGGG - Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
913567161 1:120083996-120084018 CAGAAGGAACATAAGGAGACTGG - Intergenic
914287911 1:146244703-146244725 CAGAAGGAACATAAGGAGACTGG - Intergenic
914548946 1:148695449-148695471 CAGAAGGAACATAAGGAGACTGG - Intergenic
914617735 1:149376269-149376291 CAGAAGGAACATAAGGAGACTGG + Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914852665 1:151326774-151326796 CAGAAGCAGCACAGGAAGACAGG + Intronic
915199810 1:154219113-154219135 CTAAAGAAGCAGAATGAGAGTGG + Intronic
915453015 1:156020102-156020124 CTCAAGCAGAGGAAGGAGCCAGG - Exonic
915608568 1:156971707-156971729 CTGAAGATCCAGCAGGAGACTGG - Exonic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918156371 1:181850628-181850650 TTGGAGTACCAGAAGGAGACAGG + Intergenic
918375890 1:183908726-183908748 CTGAGGCAGCAGAAGGAATTGGG + Intronic
919031652 1:192250751-192250773 CTGGAGTACCTGAAGGAGACAGG - Intergenic
919586471 1:199446749-199446771 TTGGAGTACCAGAAGGAGACGGG - Intergenic
919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG + Intronic
920114042 1:203607333-203607355 TTGAGGCAGCACAAGGACACCGG + Intergenic
920676086 1:208039706-208039728 ATCAAGCAGCAGATGGAGAAGGG - Exonic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
923268899 1:232337082-232337104 CTGAAGCCCCCGAAGGACACAGG - Intergenic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
924637857 1:245805898-245805920 CTGAAGCAGTAGAAGGAACTTGG - Intronic
924638864 1:245814342-245814364 CTGAAGCAGCACCAGGAATCAGG + Intronic
924779489 1:247133315-247133337 CTGGAGTACCAGCAGGAGACAGG + Intronic
924809754 1:247390445-247390467 CTGCAGCAGCAGCTGGAGTCGGG + Intergenic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
924855611 1:247872520-247872542 TTGAAGCAGAAGAAGGGCACAGG + Intronic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064322904 10:14322230-14322252 CTGAGGCAGCAGAAGCAGCATGG + Intronic
1065624851 10:27619829-27619851 CTGGAGCAGGAGAGAGAGACGGG + Intergenic
1066402679 10:35090590-35090612 CAGCAGCGGAAGAAGGAGACCGG - Intronic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1067540602 10:47149372-47149394 CTGAAACAGAAAAAGGACACTGG + Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1067770116 10:49116562-49116584 CTGTAGGAGGAGGAGGAGACAGG + Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068126726 10:52850229-52850251 TTGGAGTACCAGAAGGAGACGGG - Intergenic
1068914095 10:62409603-62409625 CTGAAGCACAAGAAGGAAATGGG - Intronic
1069087790 10:64161694-64161716 CTGAAGCAGGAAAAGTAGCCGGG - Intergenic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1069897421 10:71688324-71688346 CTGCAGTGGCTGAAGGAGACAGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070826026 10:79391107-79391129 CTGAGGCCCCAAAAGGAGACAGG - Intronic
1071210567 10:83337240-83337262 CTAAAGCAGCTCAAGGAGATGGG + Intergenic
1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG + Exonic
1072715438 10:97749417-97749439 TCGTAACAGCAGAAGGAGACGGG - Intronic
1073464848 10:103688645-103688667 TTTAAGGAGCAGAAGGTGACTGG + Intronic
1074519863 10:114209315-114209337 GTGAAGAAGCAGAAGCTGACTGG + Intronic
1075141424 10:119840220-119840242 CTCAAGAAGCAGAAGTGGACTGG - Intronic
1075945632 10:126430699-126430721 CTCATTCAGCAGAAGCAGACAGG + Intronic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076413166 10:130265911-130265933 ACGAAGCTGCAGATGGAGACGGG + Intergenic
1076546897 10:131251341-131251363 AGGAAGCAGCAGAGGGAGAGGGG - Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1077270915 11:1680026-1680048 CTGAGCCAGCAGGAAGAGACAGG + Intergenic
1077498850 11:2899892-2899914 ATGAAGCGGCAGGAGGAGATGGG - Intronic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1079103530 11:17556499-17556521 CTGAAGCAGGAGATGAGGACAGG - Intronic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1079913543 11:26339928-26339950 CTGCAGCAGCTGCAGGATACAGG + Intronic
1079929239 11:26537329-26537351 CTGAAGCAACAGAAATATACGGG - Intronic
1080164737 11:29223571-29223593 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1080929084 11:36788535-36788557 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1081454802 11:43211311-43211333 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081693019 11:45090887-45090909 ATGAAGCAGAAGAGGAAGACAGG + Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083208643 11:61168698-61168720 CTGATGCAGGGGAAGGAGATGGG - Intergenic
1083270421 11:61569500-61569522 CTGGGGCAGCAGAGGGAGCCAGG + Intronic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084399883 11:68937347-68937369 CTGCAGCAGCAGGAGGGGCCTGG + Intronic
1084690477 11:70722416-70722438 CTGGAGGAGCAGAAAGGGACAGG - Intronic
1084706636 11:70819707-70819729 CTGAAGCAGCCCCAGGTGACAGG - Intronic
1085166079 11:74400537-74400559 CTGATGCAGCAGAACTGGACTGG - Intergenic
1085651023 11:78268806-78268828 CTGAAGGAGGAAAAGGAGACAGG - Intronic
1085822062 11:79804110-79804132 CTGAGGCAGGAGAATCAGACAGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086539427 11:87890390-87890412 CTTAAGCAGCAGAAGAACATAGG - Intergenic
1086771531 11:90773755-90773777 CTGGAGTACCAGAAGGAAACAGG - Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087091173 11:94274624-94274646 CTCCAGCAGCAGAAGGAAACAGG - Intergenic
1087513646 11:99129487-99129509 CTGAAGTACCTGAAAGAGACAGG + Intronic
1088461325 11:110086516-110086538 CTGAACTAGCAGAAGAAGGCAGG - Intergenic
1088619993 11:111671986-111672008 CTGCAGCAGCAGAAGATGGCTGG - Intronic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088748371 11:112823240-112823262 CTGTTATAGCAGAAGGAGACAGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1090915603 11:131159892-131159914 CTGAAACACTGGAAGGAGACAGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091697932 12:2640579-2640601 CTGCAGCTGAAGAAAGAGACTGG + Intronic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1092639942 12:10494773-10494795 TTGGAGTACCAGAAGGAGACGGG + Intergenic
1092835832 12:12487162-12487184 CTGATGCAGCAGAATGGGATTGG - Exonic
1093092456 12:14936989-14937011 CTGAAGGAGCAGAATAAGAGAGG - Intronic
1093212247 12:16321855-16321877 CATAAGCAGAAGAAGGAAACAGG - Intergenic
1093537100 12:20235453-20235475 CTGAACCATCAGAAAGTGACGGG - Intergenic
1094328997 12:29272248-29272270 TTGCAGTACCAGAAGGAGACGGG - Intronic
1094797516 12:33993112-33993134 CGAAAGCAGCACAAGGAGCCTGG + Intergenic
1095377386 12:41546684-41546706 TTCAAGCTGCATAAGGAGACAGG + Intronic
1095594120 12:43939579-43939601 CTGAAGTGGCAGTAGGAGAAGGG - Intronic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1097029902 12:56082665-56082687 CTGAACCAGAGGAAAGAGACTGG + Intronic
1097214596 12:57400638-57400660 CTGCAGGAGCAGAAGGTGTCTGG - Intronic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1099555844 12:84107564-84107586 CAGAAGGAGCAGAAGTATACTGG + Intergenic
1101190936 12:102331625-102331647 CTGAATCAGCAGAAAAAGAAGGG + Intergenic
1102737023 12:115171180-115171202 TTTAAGCAGCAGCAGAAGACAGG + Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103844157 12:123889855-123889877 CTGAAGCAGTTGGAAGAGACAGG - Intronic
1103955445 12:124573961-124573983 CTGAAGGAGCAGAGGAAGCCGGG - Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104065843 12:125305158-125305180 CTGAAGAAGTTGTAGGAGACGGG - Intronic
1104256238 12:127141916-127141938 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1104655375 12:130570533-130570555 CAGGAGCAACAGAAGGTGACAGG + Intronic
1104778829 12:131406732-131406754 CTGATGCTGCAGGTGGAGACAGG - Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106406351 13:29478147-29478169 CTGAAGGAGACTAAGGAGACAGG + Intronic
1106701043 13:32228915-32228937 ATGATGCAGCAGATGGAGGCAGG + Intronic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1109040780 13:57333589-57333611 CTGAAACAGGAGAAGGGGATAGG + Intergenic
1109810686 13:67509267-67509289 CTGAAGCAGCTGTGGGACACAGG - Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1111159974 13:84382356-84382378 CTGAAGTAGTGGCAGGAGACAGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1112416679 13:99208812-99208834 CTGAAGCACCTGCAGGACACAGG - Intronic
1112927368 13:104693189-104693211 CTGAAGCAGCTGGAGGTGATTGG - Intergenic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1115494044 14:33984987-33985009 CTGAGGCAGGAGAATCAGACAGG + Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1116072507 14:40066783-40066805 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
1116181079 14:41536648-41536670 ATGAAGCAGAAGAATGAAACTGG - Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1116560767 14:46376210-46376232 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1117116083 14:52514001-52514023 CAAAATCAGCAGAATGAGACAGG + Intronic
1117287043 14:54295946-54295968 CTGAAAGACAAGAAGGAGACGGG - Intergenic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118072234 14:62257702-62257724 ATGATGCAGCAGAGGGAGGCAGG + Intergenic
1119102814 14:71895944-71895966 TAGAAGCACCAGCAGGAGACTGG - Intergenic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119693660 14:76695871-76695893 CTGAGGCAGCAAAAGGGGAAGGG - Intergenic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120502642 14:85316010-85316032 CTGATGAAGTAAAAGGAGACAGG - Intergenic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1120575956 14:86181135-86181157 CAGAAGCAGAAGAAGGGGAAGGG + Intergenic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122905053 14:104797775-104797797 CAGCAGCTGCAGAAGGTGACAGG - Intergenic
1122993802 14:105251612-105251634 CTGCAGCAGCAGAGGGGCACCGG - Intronic
1123681831 15:22769243-22769265 CTGAAGCAGAAGGAGCAGATGGG - Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124723244 15:32131973-32131995 CTGAAACAGCAGGAGGCGGCTGG + Intronic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1125026350 15:35033711-35033733 CTGAAGCAGTTGAATTAGACAGG + Intergenic
1125124929 15:36209017-36209039 CTGAAGCATTAGAATGTGACTGG + Intergenic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126450783 15:48806340-48806362 CAGAAGCAGCAGCAGGAAATGGG + Intronic
1126896358 15:53261230-53261252 CTGGAGTAGGAGAAGCAGACTGG + Intergenic
1127930823 15:63596252-63596274 GTGAAGCAGCATGAGGAAACGGG + Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129687192 15:77693479-77693501 ATGAAGCTGCAGAGGGAGGCTGG + Intronic
1129824509 15:78625823-78625845 ATGATGCAGCAGGAGGAGGCTGG - Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130875478 15:88010198-88010220 CTGAAGGAGTAGACAGAGACTGG - Intronic
1131325130 15:91435959-91435981 CTGAAGTAGCATAAGGAGCATGG - Intergenic
1132552484 16:559289-559311 CTGAAACAGCACAGGGAGCCCGG - Intergenic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1133114422 16:3568358-3568380 TTGGGGCAGCATAAGGAGACTGG - Intronic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137637111 16:49996218-49996240 CTGAAGCAGCTGGAGGGCACTGG + Intergenic
1137694581 16:50453018-50453040 GAGAAGCAGCAGAAGAAGAAAGG + Intergenic
1137801310 16:51264496-51264518 CTGAAGCACCAGGAAGACACTGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138756561 16:59493511-59493533 CTGAAGCAGAAGAGGAAGAGAGG - Intergenic
1139431099 16:66911452-66911474 CTGAAGCTGGAGAGAGAGACTGG - Intronic
1140270889 16:73465455-73465477 CAGAGGCACCAGGAGGAGACGGG - Intergenic
1141138228 16:81480575-81480597 CTGGAGCAGCAGAATGGGTCAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142390424 16:89796239-89796261 GCGAAGGAGCAGAAGGAAACAGG + Intronic
1142539495 17:647080-647102 TGGAGGCAGCAGAGGGAGACAGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143404210 17:6666284-6666306 CTGAAGCTTCTGAAAGAGACAGG + Intergenic
1143455782 17:7066792-7066814 CTGAAGCAGGAGAAAGAAACTGG + Intergenic
1144471244 17:15543294-15543316 CTAAACCAGCAGAAAGAGAAGGG + Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1144925222 17:18801399-18801421 CTAAACCAGCAGAAAGAGAAGGG - Intronic
1145304344 17:21664814-21664836 CTACAGCAACACAAGGAGACAGG + Intergenic
1145802075 17:27694039-27694061 CAGAAGGAGCAGAAGTATACTGG + Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1146573831 17:33974894-33974916 TTGAAGCAGGAGAGGAAGACAGG - Intronic
1146718607 17:35107015-35107037 CTGAAGCAGCTGGAGGAGGCGGG + Exonic
1147970525 17:44217300-44217322 CAGAAGCAGAAGCAGGATACAGG + Intronic
1149923783 17:60682329-60682351 CTGAATCAGAATAAGGAGAGTGG + Intronic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150490106 17:65568529-65568551 CTGAAGCAGGAGAATGACATGGG - Intronic
1150649638 17:67001404-67001426 CTGAGGCGGCAAAAGGAGGCTGG - Intronic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152092120 17:78252814-78252836 CTTCAGGAGCAGAAGCAGACTGG - Intergenic
1155185502 18:23383529-23383551 CAGGAGCAGCAGAAGGTGACAGG + Intronic
1155313878 18:24551997-24552019 GTGAGCCAGCAGAAGGAGAATGG - Intergenic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157209904 18:45733243-45733265 CTAAAGAAGGAGAAGAAGACGGG + Intronic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1159902798 18:74063791-74063813 TTGAAGAAGCGGAAGGTGACAGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160999993 19:1905738-1905760 CGGAAGCAGCTGGAGGATACGGG - Intronic
1161325337 19:3661000-3661022 CGGAAGTAGCGGAAGGCGACAGG + Exonic
1162264076 19:9555916-9555938 CCGAAGCAGGAGCAGGAGAGAGG + Intergenic
1162268773 19:9597184-9597206 CTGAATGAGCAGAATGAGTCAGG + Intergenic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1163704263 19:18803229-18803251 CTTAAGCATCACAAGGAAACAGG + Intergenic
1164031806 19:21413918-21413940 CAGCAGTTGCAGAAGGAGACGGG - Intronic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164335974 19:24321636-24321658 CAGAAGGAGCAGAAGTATACTGG - Intergenic
1165410145 19:35654831-35654853 AGGCATCAGCAGAAGGAGACAGG - Intronic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1167267083 19:48488593-48488615 CTCAAGGAACAGAAGGACACTGG - Intronic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167448405 19:49552963-49552985 CCGTAGCAGAAGAAAGAGACGGG - Intergenic
1167463381 19:49638103-49638125 CCTGAGCAGGAGAAGGAGACGGG - Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167887761 19:52516147-52516169 CTGAAGGAGGAGAAAGGGACAGG - Intergenic
1167910878 19:52700778-52700800 CTGAAGGAGGAGAAAGTGACAGG + Intergenic
1167937661 19:52921090-52921112 CTGAAGGAGGAGAAAGGGACAGG + Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
1168384940 19:55955274-55955296 CTGAAACAGCAAATGGAGAGAGG + Exonic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925447338 2:3939487-3939509 TTGGAGTACCAGAAGGAGACAGG - Intergenic
926225013 2:10961249-10961271 CTGGAGGAGCAGAACGAGCCCGG - Intergenic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927306512 2:21579677-21579699 CTGAAGCTGGAAAACGAGACAGG + Intergenic
927889756 2:26740962-26740984 CTGGAGCTGCTCAAGGAGACAGG + Intergenic
929418941 2:41771329-41771351 TTGAATCAGCTGAAGGTGACTGG - Intergenic
929509574 2:42556196-42556218 GAGAAGCAGAAGAATGAGACTGG - Intronic
929518046 2:42622305-42622327 CTGAGGCAGGAGAATCAGACAGG + Intronic
930023620 2:47016312-47016334 GTGAATCAGCATCAGGAGACTGG + Intronic
930941046 2:57014520-57014542 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
931858380 2:66328049-66328071 CCAGAGCGGCAGAAGGAGACTGG + Intergenic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
933129645 2:78656346-78656368 CTGGAGCACCTGAAGGAGACAGG + Intergenic
934039565 2:88116683-88116705 AAGAAGCACCAGCAGGAGACTGG + Intergenic
934737668 2:96698184-96698206 CAGAAGGTGCACAAGGAGACAGG - Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
936732407 2:115400025-115400047 CTGGAGCAGGAGCAAGAGACGGG + Intronic
937258008 2:120568359-120568381 CTGACACAGCAGGAGGAGCCAGG - Intergenic
937488390 2:122339656-122339678 CTGAAACAGCGTCAGGAGACGGG + Intergenic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
939249638 2:139667336-139667358 CTGATTCAGCAGAGGGAGAGAGG - Intergenic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
940008197 2:149029265-149029287 CTGAAGAAGCAGAAGAATATAGG - Intergenic
940147772 2:150565300-150565322 GTGAAACAGCAGAAGGATAAAGG + Intergenic
940269299 2:151874001-151874023 CTGGAGCAGGAGGAAGAGACGGG - Intronic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941933678 2:170966453-170966475 CGGAAGGAGCAGCAGGGGACAGG - Exonic
942053453 2:172162263-172162285 CTCAAGCAGAAGATGGAGACAGG - Intergenic
942621186 2:177845919-177845941 CTGAGGCAGGAGAATCAGACAGG + Intronic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
948766151 2:240220557-240220579 GAGAAGCAGCAGAATTAGACAGG - Intergenic
948882950 2:240869590-240869612 CAGAAACAGCTCAAGGAGACTGG - Intronic
1168783282 20:513659-513681 TTGAAACAGCAGAAGAAGACTGG - Intronic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1170426220 20:16237823-16237845 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1171383147 20:24748280-24748302 TGGGAGCAGCAGAAGGAAACAGG + Intergenic
1171521864 20:25782246-25782268 CTACAGCAACACAAGGAGACAGG + Intronic
1171554961 20:26073637-26073659 CTACAGCAACACAAGGAGACAGG - Intergenic
1172293317 20:33791269-33791291 CTGGAGGAGCTGAAGGACACAGG + Exonic
1172590165 20:36112225-36112247 CTGAAGCGGCAGCAGGGGCCAGG - Intronic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1173849500 20:46209092-46209114 AGGAAGCAGCAGAGGAAGACAGG + Intronic
1174116063 20:48227074-48227096 CTTAAGCAGGAGATGGAGGCAGG - Intergenic
1174365783 20:50055367-50055389 CTGAAGCTGCAGGAGCAGTCCGG + Intergenic
1174406435 20:50306166-50306188 ATGAAGCAGGAAAAGGAGATGGG + Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175471618 20:59233975-59233997 CAGAAGTAGAAGAAGCAGACAGG - Intronic
1176411504 21:6451702-6451724 GGGAAGCAGCAGAGGGAGTCAGG + Intergenic
1176655668 21:9587243-9587265 CTACAGCAACACAAGGAGACAGG + Intergenic
1176660400 21:9629736-9629758 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1177480282 21:21677440-21677462 CAGAACCAGAAGAAAGAGACAGG + Intergenic
1178320595 21:31602255-31602277 CAGCAGCAGCAGAAGAAAACTGG + Intergenic
1178497439 21:33099246-33099268 CTGAAACAGCAGAAGGGCCCAGG + Intergenic
1178853206 21:36230268-36230290 CCAAAGCAGGAGAAGGAGAGCGG - Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178978107 21:37237983-37238005 CTTAACCAGCAGAGGTAGACAGG + Intronic
1179344487 21:40544101-40544123 CTGCAGCATCAGCAGGAGTCAGG + Intronic
1179686998 21:43060024-43060046 GGGAAGCAGCAGAGGGAGTCAGG + Intronic
1179775581 21:43659773-43659795 GTGAAGACGCAGAGGGAGACAGG + Exonic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1180848147 22:18995519-18995541 CTGAACCAGTGGAGGGAGACTGG + Intergenic
1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG + Exonic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1181894029 22:26090954-26090976 CTGAAGCAGCAGACCCAGAAGGG - Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182420670 22:30247147-30247169 CTGGACTAGCAGATGGAGACTGG + Intergenic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182600387 22:31458696-31458718 CTGAAGCCACAGAGGGACACTGG - Intronic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184561146 22:45263630-45263652 GTGGAGCAGAAGAAGGAGCCGGG - Intergenic
1184956404 22:47889718-47889740 CTGGAGCAGGAGAAAGAGAGAGG - Intergenic
949466066 3:4345059-4345081 TTGGAGTACCAGAAGGAGACAGG + Intronic
949597233 3:5560917-5560939 TTGAGACAGCAGAAGGTGACAGG - Intergenic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950360931 3:12448869-12448891 GTGAAGCAGGACAAGGAGAAGGG - Intergenic
951089259 3:18553133-18553155 TTTATACAGCAGAAGGAGACAGG - Intergenic
952027677 3:29102907-29102929 GGGAGGCAGCAGAAGGAGAGAGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
955134527 3:56203311-56203333 TTGTAGAAGCTGAAGGAGACCGG + Intronic
955503546 3:59608556-59608578 GTGAGGCAGCAGGTGGAGACTGG - Intergenic
956417800 3:69051795-69051817 CTGAAGCAGCATTAGGGAACGGG + Intronic
957134311 3:76265152-76265174 CTGAAGCAGAAAAAGGACCCAGG - Intronic
957291507 3:78282833-78282855 TTGGAGTATCAGAAGGAGACAGG + Intergenic
957639123 3:82827614-82827636 ATGAAGCAGAAGAAAGAGAGGGG - Intergenic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
958073092 3:88640006-88640028 TTGGAGTACCAGAAGGAGACAGG - Intergenic
958503594 3:94945507-94945529 CTGGAGTACCGGAAGGAGACGGG - Intergenic
958656326 3:97008221-97008243 TTGGAGTACCAGAAGGAGACAGG - Intronic
958911582 3:100000178-100000200 CTGAAGGATCAGAAGAAGGCAGG - Intronic
959205689 3:103303803-103303825 TTGGAGTACCAGAAGGAGACAGG - Intergenic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960260876 3:115567063-115567085 ATGAAGGAGATGAAGGAGACTGG + Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
961022953 3:123524823-123524845 CTGATGCAGCAGAAAGACCCTGG + Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961456669 3:127027979-127028001 ATCAAGCAGCAGATGGAGAAGGG + Exonic
961923471 3:130451385-130451407 CAGAAGGAGCAGAAGTATACTGG + Intronic
961990073 3:131180105-131180127 CACAAGCAGCAGAAGTAGATTGG + Intronic
962409100 3:135125876-135125898 TTCAAGAAGCAGAAGCAGACAGG - Intronic
962494707 3:135927334-135927356 ATGAAACAGCATTAGGAGACTGG + Intergenic
962692098 3:137908819-137908841 TTGGAGTACCAGAAGGAGACCGG + Intergenic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
964108364 3:153063165-153063187 AAGAAGCAGCAGAGGGAGAGGGG - Intergenic
966020525 3:175203305-175203327 AGGAAGCAGCAGAAGGACCCTGG - Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966309129 3:178574331-178574353 CTGAAGCCCCAGGAGGAGCCAGG - Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
967504449 3:190238393-190238415 GAAAAGCAGCAGGAGGAGACAGG + Intergenic
967570893 3:191027160-191027182 CTGAAGTGGCAGTAGCAGACAGG - Intergenic
968201983 3:196762585-196762607 CTGAGGCAGGAGAATCAGACAGG + Intronic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
970710144 4:18852164-18852186 CTTCAGCAGCAGAAGTATACAGG + Intergenic
970952586 4:21774553-21774575 GTGGAGTACCAGAAGGAGACAGG - Intronic
971134674 4:23855253-23855275 CTTTAGCAGCAGAGTGAGACTGG + Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
971899981 4:32646794-32646816 CAGAAGGAGCAGAAGTATACTGG - Intergenic
972270858 4:37509862-37509884 CTGAGGCAGCAGAATCAGGCAGG + Intronic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
973849356 4:54945924-54945946 CTGAAGCAGGAGAGGGCGAGAGG - Intergenic
974305582 4:60134549-60134571 ATGAAGCATCAGAAGCAGGCTGG - Intergenic
974413189 4:61568481-61568503 TTGAAGCAGTAGAAGAAGAAAGG + Intronic
974672499 4:65050471-65050493 CTGAAGCAGGAGAAGGACTGCGG - Intergenic
974768815 4:66384067-66384089 TTGGAGTACCAGAAGGAGACTGG + Intergenic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976339919 4:83935437-83935459 TTGAATCAGCAGAAGGACAAAGG - Intergenic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
978206325 4:106084462-106084484 CCGGAGTACCAGAAGGAGACAGG + Intronic
978405073 4:108370702-108370724 CTGAAGCAGTAGACGAACACAGG + Intergenic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
979069775 4:116187235-116187257 CTGATGAAGCAGAAAGAGATAGG - Intergenic
979198121 4:117944061-117944083 CTGAAGCAGGAGGAAGAGAGAGG + Intergenic
980605877 4:135088079-135088101 CTGAAGGAGTAAAGGGAGACGGG + Intergenic
980876811 4:138670082-138670104 CTGAAGCAGAAGATTGAGGCAGG + Intergenic
981089412 4:140717212-140717234 CTGAACCAGGAGATGCAGACAGG + Intronic
981236881 4:142427654-142427676 CTGAAGCAGCAGAAGCAATTAGG - Intronic
981724699 4:147834797-147834819 CTGACCCAGGGGAAGGAGACAGG - Intronic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
984029123 4:174581523-174581545 CTGAAGCTTGAGAAGGAGAGAGG - Intergenic
984092258 4:175388578-175388600 CTGGAGTACCTGAAGGAGACAGG + Intergenic
984121118 4:175745807-175745829 CTGAGGCTGGAGAAGGAGATGGG + Intronic
985414957 4:189726681-189726703 TTAAAGCAGCAGTAGGAGGCAGG + Intergenic
985665874 5:1181289-1181311 CAGAAGCCTCAGAAGGAGAAGGG - Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986392620 5:7300297-7300319 CGGAAGCAGGAGAAGCAGATGGG - Intergenic
986392666 5:7300591-7300613 CTGAAGCAGAAGAAGCAGATGGG - Intergenic
986392674 5:7300654-7300676 CGGAAGCAGGAGGAGCAGACGGG - Intergenic
986445992 5:7821813-7821835 CTGATGGAGCAGAAGGGGAAGGG + Intronic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988335812 5:29908077-29908099 CTGAAGGAGCAGAGGGGGAGGGG - Intergenic
988448354 5:31312821-31312843 GTGAGGCAGAAGAAGGAGATAGG - Intronic
989019040 5:36978784-36978806 CATAAGCAGAAGAACGAGACGGG - Intronic
989318071 5:40104897-40104919 CAGAAGGAGCAGAAGTATACTGG - Intergenic
989555753 5:42792680-42792702 CTGAACTAGCACAAGGAAACAGG - Intronic
989633339 5:43510537-43510559 CTGAGGCAGGAGAATCAGACAGG - Intronic
989682459 5:44045692-44045714 CTGGAGTACCTGAAGGAGACAGG - Intergenic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
992122145 5:73605801-73605823 CTAAAACAGAAAAAGGAGACGGG - Intergenic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995942507 5:117600683-117600705 CTGAGGCAGGAGAATCAGACAGG + Intergenic
996432999 5:123401946-123401968 CTGCAGCAGCAGAAGACGGCCGG - Intronic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
996893992 5:128457327-128457349 CTGGAGTACCAGGAGGAGACAGG + Intronic
997274859 5:132576673-132576695 ATAAAGGAGAAGAAGGAGACAGG - Intronic
997584665 5:135037271-135037293 CTGAAGCAGCAGGCAGAGTCCGG - Intronic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998131402 5:139653191-139653213 TGGAAGCCGCAGAGGGAGACAGG + Intronic
998887259 5:146707215-146707237 CTGCAGCAGCAGAAGACGGCTGG - Intronic
999446686 5:151646022-151646044 CTGAAGCAGCAGAGGATGAATGG + Intergenic
999528054 5:152430157-152430179 CTCAAGCAGCTGAATGAGGCTGG - Intronic
999953435 5:156674598-156674620 GTCAAGCATCAGAAGGAGAGAGG + Intronic
1000744992 5:165021380-165021402 CTAAAGAAGAGGAAGGAGACTGG + Intergenic
1001595637 5:172896998-172897020 AGGCAGCAGCAGATGGAGACTGG - Exonic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1004152337 6:13133390-13133412 CTGAGGCAGGAGAATCAGACAGG - Intronic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1006621900 6:35371195-35371217 ATGATGCAGAAGAAAGAGACTGG + Intronic
1006903421 6:37517274-37517296 CTGCAGCAGCTGCAGGACACAGG + Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1008468095 6:51853539-51853561 TTGGAGTACCAGAAGGAGACAGG - Intronic
1008603221 6:53116074-53116096 CTGTAGTAGCAGAAGGCGCCAGG - Intergenic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1012742992 6:103044108-103044130 CTGAAGCCGCAAAAGAAAACAGG - Intergenic
1013298836 6:108783812-108783834 CTGAAGGACCTGTAGGAGACAGG + Intergenic
1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG + Intergenic
1013956640 6:115849725-115849747 CTAAAGCAATAGAAGAAGACAGG + Intergenic
1014367396 6:120561821-120561843 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1015883576 6:137893329-137893351 CTAGAGCAGCAGAAGGGGAGGGG - Intergenic
1016406964 6:143741147-143741169 CTGAGGCAGGAGAATGAGTCAGG + Intronic
1016454604 6:144217357-144217379 CGGAAGAAGCCGAAGGAGACAGG - Intergenic
1016562971 6:145417894-145417916 CTGAAGGAGCTGAAGGAGTGTGG - Intergenic
1016754963 6:147674827-147674849 GGGAAACAGCAGAAGGAGAGTGG - Intronic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017589190 6:155960140-155960162 CAGAAGCAGCAGGAAGAGACAGG - Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018129845 6:160718468-160718490 CCATAGCAGCAGAATGAGACCGG - Intronic
1018278994 6:162164305-162164327 CTGAGGCAGGAGATGGAGATGGG - Intronic
1018327728 6:162691841-162691863 CTGAAGCAGCAGTAGCAGCCTGG + Intronic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1018998482 6:168727809-168727831 CTGAAGAACCAGAAGGCAACAGG - Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1019882080 7:3870467-3870489 TTGAAGGAGCAGTGGGAGACAGG - Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020261650 7:6533988-6534010 CTGAAGCAGAAGAGGGTGACGGG + Intronic
1020621948 7:10529134-10529156 TTGGAGTACCAGAAGGAGACAGG + Intergenic
1020753803 7:12175377-12175399 CTAAAGCAGAAAAAGGACACCGG + Intergenic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1020795297 7:12671573-12671595 CTGAAGCAGGAGGAAGAGAGAGG - Intergenic
1021020804 7:15596206-15596228 CTGATGCAGCTGAAGGAGCAAGG - Intergenic
1021336290 7:19406774-19406796 CCCAAGCAGCTGAAGGAGGCTGG + Intergenic
1022573463 7:31475300-31475322 CTAAATCAGCTAAAGGAGACAGG - Intergenic
1023623102 7:42092367-42092389 CTGGAGCAGCAAGAGGACACAGG + Intronic
1023710977 7:42992279-42992301 CAGGAGTAGCAGAAGGGGACAGG - Intergenic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG + Intergenic
1025143288 7:56483481-56483503 CTCACGGAGCAGCAGGAGACAGG - Intergenic
1025282357 7:57637428-57637450 CTACAGCAACACAAGGAGACAGG + Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1025302372 7:57828091-57828113 CTACAGCAACACAAGGAGACAGG - Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1025852536 7:65256566-65256588 ATGAAGCAGAAGAAGGAATCAGG + Intergenic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1028210339 7:88066741-88066763 CAGAAGCAGCAGCAAGAGAAAGG + Intronic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1029274398 7:99395708-99395730 CTGAAGCAGCACCAGGATCCTGG - Exonic
1029439399 7:100578705-100578727 CTCAGGCGGCAGAAGGAGACTGG + Exonic
1029540124 7:101177926-101177948 CTGGAGCTGCAGATGGAGTCAGG - Intronic
1029838108 7:103334462-103334484 CTGAGGCAGAAGAATGAGGCAGG + Intronic
1030209792 7:106984857-106984879 CTGAAGGAGACGAGGGAGACAGG - Intergenic
1030434697 7:109502015-109502037 CTCTAGCAGGAGAAGGAGATAGG + Intergenic
1030489249 7:110211428-110211450 CTGAAGGAGCTGAAAGAAACTGG - Intergenic
1031380585 7:121080821-121080843 CTCTACCACCAGAAGGAGACTGG - Intronic
1032468921 7:132164227-132164249 ATCAAGCAGCAGATGGAGAAGGG - Exonic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033879569 7:145863747-145863769 CTGGAGTAACTGAAGGAGACAGG + Intergenic
1034071868 7:148193910-148193932 TTGAACAAGCAGAAGGAAACGGG - Intronic
1034728884 7:153366050-153366072 CTGAAGCAGCACAAGGGGCCTGG + Intergenic
1035054684 7:156026694-156026716 CTGGGGCACCAGAAGGCGACCGG - Intergenic
1035365364 7:158345855-158345877 CTGAGGCGGCAGAAGGAGTGGGG + Intronic
1035491845 7:159286049-159286071 TTGGAGTACCAGAAGGAGACAGG + Intergenic
1035599332 8:887992-888014 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1037019091 8:13945921-13945943 CTGTAGCCATAGAAGGAGACAGG - Intergenic
1037212748 8:16411906-16411928 CTGAAGCAGAAAAAGCAGCCAGG + Intronic
1037575110 8:20195218-20195240 CTGAGGCAGAAGAAGGAAAGTGG - Intergenic
1037763959 8:21760329-21760351 CTGAAGCAGCAGAAAGCTAGTGG + Intronic
1039254801 8:35707240-35707262 CTGAAGCAACATAAGGAAATAGG - Intronic
1040748554 8:50676248-50676270 CTGGAGTACCTGAAGGAGACAGG - Intronic
1040805858 8:51395685-51395707 CTGAAAAAGCAGTAGAAGACTGG + Intronic
1041180214 8:55239536-55239558 GTGGGGCAGCAGAAGGAGAGTGG - Intronic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043673980 8:82925850-82925872 CTGAAGGAGCAGAAGTAAAAGGG + Intergenic
1044355993 8:91223791-91223813 TTGGAGTACCAGAAGGAGACAGG - Intronic
1045384846 8:101662334-101662356 CTGGGCGAGCAGAAGGAGACTGG - Intronic
1047463281 8:125088958-125088980 CGGAAACAGAAGAAGTAGACTGG + Intronic
1047995782 8:130334116-130334138 CAGAAGGAGCAGAAGCAAACTGG - Intronic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048614195 8:136056619-136056641 CTGAAGGAAAAGAAGGAGCCAGG - Intergenic
1048705442 8:137148091-137148113 CTGGAGCAGGAGAAAGAGAGAGG + Intergenic
1048873267 8:138816162-138816184 GGGAAGGAGAAGAAGGAGACAGG + Intronic
1049548131 8:143244123-143244145 CAAAAGCAGAAGAAGGAGAAAGG - Intergenic
1050476607 9:6047347-6047369 AGAAAGCAGCAGAAGAAGACCGG + Intergenic
1050670825 9:7995562-7995584 CTGAGGCAGGAGATGGAGATGGG - Intergenic
1050982476 9:12037354-12037376 CTGGAGTACCAGAGGGAGACAGG + Intergenic
1051276607 9:15404960-15404982 CTGAACCAGGAGCAGGACACAGG - Intergenic
1052325549 9:27213645-27213667 CAGAAGCAACATCAGGAGACAGG - Intronic
1052546804 9:29890138-29890160 TTGAAGTACCAGAAGGAGACTGG + Intergenic
1052998685 9:34565464-34565486 CTCAGGCAGCAGCAGGAGAAGGG + Intronic
1053479757 9:38407417-38407439 ACTATGCAGCAGAAGGAGACTGG - Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053618665 9:39794460-39794482 CTCAAGTAGCAGAAGGACATTGG - Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053876842 9:42553822-42553844 CTCAAGTAGCAGAAGGACATTGG - Intergenic
1053895834 9:42740883-42740905 CTCAAGTAGCAGAAGGACATTGG + Intergenic
1053897461 9:42757193-42757215 CTGCAGCAACAGAAGGAAAGTGG - Intergenic
1054234855 9:62547900-62547922 CTCAAGTAGCAGAAGGACATTGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054265490 9:62912969-62912991 CTCAAGTAGCAGAAGGACATTGG + Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1057222061 9:93262785-93262807 GGGAAGCAGCAGCAGGAGCCAGG - Intronic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1058058651 9:100473593-100473615 GTGTAGCAGCAGAAGGCGAGCGG - Exonic
1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG + Intronic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1058636577 9:107044041-107044063 CGGGAGCAGCAGATGGAGCCGGG + Intergenic
1059746064 9:117202951-117202973 TTGGAGTACCAGAAGGAGACAGG - Intronic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060367441 9:123032490-123032512 CTGAAGCAGCAGCAGTTGTCTGG - Intronic
1061412563 9:130429440-130429462 CTGAAACTGGAGAAGGGGACAGG + Intronic
1061902318 9:133679188-133679210 CTGATGCAGCACAGAGAGACTGG - Intronic
1062554378 9:137107358-137107380 ATGAACCGGCAGATGGAGACGGG + Exonic
1203633383 Un_KI270750v1:90704-90726 CTACAGCAACACAAGGAGACAGG + Intergenic
1203637970 Un_KI270750v1:131579-131601 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1186162392 X:6791544-6791566 CTAAAGTAGAAGAGGGAGACGGG + Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1187222406 X:17341100-17341122 CTGAAGCAGCAAAAAAAGAGAGG + Intergenic
1187653615 X:21442342-21442364 CTGAATCAGAACAATGAGACAGG + Intronic
1187960981 X:24565600-24565622 CTAGAGCACCACAAGGAGACTGG + Intronic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1189554366 X:42126788-42126810 CTGTAGCATCAGAAGGATTCTGG + Intergenic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1191997174 X:67107924-67107946 TTGATGCAGCAGATGGAGTCTGG - Intergenic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1192716590 X:73648740-73648762 CTGGAGTACCCGAAGGAGACGGG + Intronic
1193780652 X:85697808-85697830 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194927009 X:99837018-99837040 AGGAAGCAGCAGAAGGACCCTGG - Intergenic
1195147326 X:102030554-102030576 TTGAAGTATCTGAAGGAGACAGG + Intergenic
1197029953 X:121801752-121801774 TTGAAGTACCTGAAGGAGACGGG - Intergenic
1198817675 X:140609456-140609478 CTGAAGCAGAAGGAAGAGAGTGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199539342 X:148941672-148941694 CTGAAGCTGAAGAAGGAGTTGGG + Intronic
1199934626 X:152560443-152560465 CTGAAGCATAACAAGGAGCCAGG + Intergenic
1200236185 X:154468862-154468884 ATCAAGCAGCAGATGGAGAAGGG + Exonic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic