ID: 907466852

View in Genome Browser
Species Human (GRCh38)
Location 1:54643697-54643719
Sequence TTGTAGGTGTTCAAATGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907466852_907466858 2 Left 907466852 1:54643697-54643719 CCCCAACATTTGAACACCTACAA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 907466858 1:54643722-54643744 AGTCACATAAGGGTTACAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 118
907466852_907466859 14 Left 907466852 1:54643697-54643719 CCCCAACATTTGAACACCTACAA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 907466859 1:54643734-54643756 GTTACAAGAGGTGAATGTCATGG 0: 1
1: 0
2: 1
3: 11
4: 173
907466852_907466855 -9 Left 907466852 1:54643697-54643719 CCCCAACATTTGAACACCTACAA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 907466855 1:54643711-54643733 CACCTACAAGAAGTCACATAAGG No data
907466852_907466856 -8 Left 907466852 1:54643697-54643719 CCCCAACATTTGAACACCTACAA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 907466856 1:54643712-54643734 ACCTACAAGAAGTCACATAAGGG 0: 1
1: 0
2: 2
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907466852 Original CRISPR TTGTAGGTGTTCAAATGTTG GGG (reversed) Intronic
900687871 1:3960182-3960204 TTATAGGTCTTTAAATGTTCTGG - Intergenic
901205255 1:7491112-7491134 TTGGAGGAGTTCAGATGTGGAGG - Intronic
905084996 1:35365562-35365584 ATGTAGTAATTCAAATGTTGGGG + Intronic
907466852 1:54643697-54643719 TTGTAGGTGTTCAAATGTTGGGG - Intronic
908069715 1:60445159-60445181 TTGTAGCTTTTCTAAAGTTGTGG - Intergenic
908614258 1:65900132-65900154 TTGTATGTGATGAAATGTAGGGG + Intronic
910219671 1:84877613-84877635 TTATAGAGGTTCAAAAGTTGAGG - Intronic
910222273 1:84899406-84899428 TTTAAGGTGTTCAGGTGTTGGGG - Intergenic
912468303 1:109889209-109889231 TTGAATGTGTTTAAATGATGGGG + Intergenic
913373103 1:118122482-118122504 TTGTAGATGTTAAAAGGATGAGG - Intronic
913711036 1:121483726-121483748 TAGCAGGTATTCAAATGCTGTGG + Intergenic
916516252 1:165519589-165519611 TTGTATGTGATGAAATGTAGGGG + Intergenic
920053467 1:203176927-203176949 TTGTAATTGTTGAAATGTGGGGG + Intergenic
920509626 1:206541339-206541361 TTGTTGCTTTTGAAATGTTGAGG - Intronic
921331016 1:214036062-214036084 TTTTAAGTGTCCAAATGTTAAGG - Exonic
922581406 1:226701245-226701267 TTGTAGGAATTCTACTGTTGGGG - Intronic
922660309 1:227424287-227424309 TTGCAAATGTCCAAATGTTGGGG - Intergenic
1064500581 10:15968206-15968228 TTATAGGTTTTTAAATGTTGGGG + Intergenic
1066435729 10:35395573-35395595 TTGAGGGTGATCAGATGTTGAGG + Intronic
1067344623 10:45428429-45428451 TGGAAGGTGTTCACAGGTTGTGG - Intronic
1068939650 10:62668481-62668503 TGGTAGGTGCTGAAATGATGAGG - Intronic
1069128254 10:64665583-64665605 TTGTAGGTATTCAAATTTGTTGG + Intergenic
1069235683 10:66069149-66069171 TTGTAGGTGTACAATTCTAGAGG - Intronic
1071549130 10:86552763-86552785 TTGGAGGTGTTCAGATCATGGGG + Intergenic
1073950771 10:108806942-108806964 TTATAGTTGTACATATGTTGGGG - Intergenic
1074452099 10:113567670-113567692 TTGTGGGTGCACAAATTTTGAGG - Intronic
1078351623 11:10599843-10599865 TTGGAGGTGTGCAAAAGCTGAGG - Intronic
1078969577 11:16391911-16391933 TTTTAGGTATTTAAATATTGAGG - Intronic
1079473453 11:20803326-20803348 TTCTAGGTGTTCAAATTTATTGG + Intronic
1079586705 11:22134295-22134317 ATGTAGGTGCTCTAATGTTGGGG - Intergenic
1079843455 11:25433023-25433045 TTGTAAGTATTCAAATACTGGGG + Intergenic
1080030342 11:27654102-27654124 TTGTCAGTGTTCAAATGGGGAGG + Intergenic
1080283101 11:30581404-30581426 TGGTAGGTGTGCAAAGGCTGAGG + Intronic
1082238122 11:49844339-49844361 TTGTAGGTGTTGCAATGATATGG + Intergenic
1086419644 11:86626155-86626177 TTGTCTGTGTTGCAATGTTGGGG + Intronic
1090236209 11:125149410-125149432 TTGGAGGTGTTTAAAGGTTGAGG + Intergenic
1091239201 11:134041304-134041326 TTGTCTGTTTTCAAATGTAGAGG + Intergenic
1095045888 12:37504543-37504565 ATGCATGTATTCAAATGTTGTGG + Intergenic
1098383033 12:69889547-69889569 ATGTAGGTGTTCAAAAATTTTGG + Intronic
1098755703 12:74360836-74360858 TTATTGGTTTTCAAATGTTGAGG - Intergenic
1099021907 12:77416798-77416820 TTGAAAGGCTTCAAATGTTGAGG - Intergenic
1102277550 12:111595078-111595100 TTGTAGTTTGTCAAATATTGTGG - Intronic
1103660828 12:122514923-122514945 TTATAGTTGTGCAAATGTTTAGG + Intronic
1104263641 12:127209795-127209817 TTGAAGGTGATGAAATGTTCTGG + Intergenic
1106536825 13:30652243-30652265 TTGTAGGTACTTAAATTTTGAGG + Intronic
1106949582 13:34868192-34868214 TTATAGAAGCTCAAATGTTGCGG - Intergenic
1107687917 13:42922650-42922672 AGGGAAGTGTTCAAATGTTGCGG + Intronic
1109331058 13:60930377-60930399 ATGTAGATTTTCAAGTGTTGAGG - Intergenic
1109932336 13:69232574-69232596 ATCTAGTTGTTCCAATGTTGAGG + Intergenic
1111055413 13:82942960-82942982 ATGTAGGTGGTAATATGTTGTGG + Intergenic
1114907281 14:27145881-27145903 TTGTATGTGCTGAAATGTAGGGG + Intergenic
1115566334 14:34628717-34628739 TGGTAGGTGATAAAATATTGTGG - Intronic
1115827185 14:37291232-37291254 TTTTAGGTCTACAAATGTTTTGG + Intronic
1116493214 14:45530326-45530348 TTGTATATGTTGAAATGTAGGGG - Intergenic
1120226064 14:81792024-81792046 TAGGAGGAGTTTAAATGTTGAGG + Intergenic
1124684931 15:31774396-31774418 TCCAAGGTGTTCAAATGTTTTGG - Intronic
1125059817 15:35405913-35405935 TTGAAGTTTATCAAATGTTGAGG + Intronic
1127493981 15:59492388-59492410 AGGTAGGTGTTCAAATGTTGGGG + Exonic
1128561059 15:68667998-68668020 TTGTACGTGTTCAACAGGTGTGG - Intronic
1128721914 15:69956372-69956394 GTGTATGTGTCCAAATGGTGAGG + Intergenic
1131151315 15:90049092-90049114 TTGTATGTGTACATATATTGTGG + Intronic
1134124697 16:11608455-11608477 TTTTAGGTTTTCAATTCTTGTGG - Intronic
1136170143 16:28484206-28484228 TTGAAAGTGTTCAAAGGTAGAGG - Intronic
1136469459 16:30469641-30469663 TTTTAGGTGATGAAATGTTCTGG - Intergenic
1138390200 16:56664832-56664854 TTATGAGTGTTCAAATGTTGGGG + Intronic
1138996782 16:62464309-62464331 ATCTGGGTGTTCCAATGTTGGGG - Intergenic
1141456065 16:84143488-84143510 TTGTAGGTGATTAAATGTTCTGG + Intronic
1148860753 17:50603210-50603232 TTGGAGGTGTTCCAGTGCTGGGG - Intronic
1149592275 17:57839372-57839394 TTATACGTGTACACATGTTGTGG - Exonic
1149959583 17:61093300-61093322 TTGTGGGTGGTCAAGTGTGGTGG + Intronic
1150948104 17:69769498-69769520 ATCTGGGTGCTCAAATGTTGGGG + Intergenic
1155276395 18:24192107-24192129 TTGTGTGTGTTCAAATGTCTTGG - Intronic
1156805665 18:41176829-41176851 TTTTAGGTTTTCAAATGTAAAGG + Intergenic
1161671258 19:5611851-5611873 TTGTAGGTGTTTAAATCTGTGGG - Intronic
1165337587 19:35182649-35182671 CTGTATGAGTTCAAATGCTGGGG - Intergenic
926114231 2:10201785-10201807 TGGTATGTGTTCCAAGGTTGTGG - Intronic
927218918 2:20688534-20688556 TTGGAGGTGATCAAGTGCTGGGG + Intronic
930944318 2:57053487-57053509 TTGTAGGAGAGCAAATGGTGAGG - Intergenic
934530340 2:95082933-95082955 TTGTAGGTGTCTGAATGTTTAGG + Intergenic
935024221 2:99261069-99261091 TTGGAGGTATTGAAATGCTGGGG + Intronic
935862826 2:107351807-107351829 ATCTGGGTGTTCTAATGTTGGGG - Intergenic
938162084 2:128995088-128995110 TTATTGGTGTTGAAAGGTTGGGG + Intergenic
938162280 2:128996742-128996764 TTATTGGTGTTGAAAGGTTGGGG + Intergenic
942795302 2:179811619-179811641 TTGTACATGTTAAAATGTAGAGG - Intronic
943666190 2:190611231-190611253 TTGTATGTGTTCCAAAGTTATGG - Intergenic
945118489 2:206433846-206433868 TTCCAGGTATTCAAATGTTTGGG - Intergenic
945729805 2:213519900-213519922 TTGTAGGTGTAAACAAGTTGAGG + Intronic
946178067 2:217933968-217933990 TTGTATGTGTTCAAATAATATGG - Intronic
947191050 2:227504951-227504973 TTGATGGTGTTTAGATGTTGTGG + Intronic
1170658135 20:18309684-18309706 TGGTAGGTGATCAAATATTCAGG + Intronic
1171892565 20:30729146-30729168 TTGTAGGTGATGAAATGGAGGGG - Intergenic
1174311844 20:49662250-49662272 TTGTATGTTTGCATATGTTGGGG - Intronic
1175537771 20:59727039-59727061 TTGTAGGTGATGAAAGGTTCTGG - Intronic
1177295548 21:19169562-19169584 TTGTAGATCTTCACATTTTGGGG - Intergenic
1177761195 21:25403650-25403672 TTCTAGGTTTTCAAATTTTTTGG - Intergenic
1179327366 21:40361165-40361187 CTGTACGTTTTCAAATGTTTGGG - Intronic
1183347296 22:37314896-37314918 TGGAAGGTGTGCAAATGTGGGGG - Exonic
954501282 3:51018750-51018772 ATGTCGGTGTTCAAAAGTTTTGG + Intronic
954632013 3:52052825-52052847 TTGGGGGAGTTCAAATGCTGAGG + Intronic
956840081 3:73131216-73131238 TTGGAGGTGTTTAAATCATGAGG - Intergenic
957699416 3:83689181-83689203 ATTTAGGTGCTCCAATGTTGGGG + Intergenic
957782620 3:84838926-84838948 TTGTTTGTTTTCAGATGTTGAGG + Intergenic
958584699 3:96071206-96071228 TAGTAGGTATTCAAACCTTGAGG + Intergenic
960497425 3:118391899-118391921 TTGTAGGTGTATATATTTTGGGG + Intergenic
960505925 3:118493966-118493988 TTGTAGGTGTTCCAAGGTTTGGG + Intergenic
966568836 3:181416884-181416906 TCTTTGGTGTTCATATGTTGTGG + Intergenic
967439702 3:189492349-189492371 TTTTAGGTGTTCCCATGGTGTGG - Intergenic
967521437 3:190437231-190437253 GTCTAGGTGTTCAAATAGTGAGG + Intronic
967592130 3:191290440-191290462 TTATAGTTGTGCAATTGTTGAGG - Intronic
967909735 3:194532146-194532168 TTGTAAGTGTGCAAATTTGGGGG + Intergenic
969647641 4:8441714-8441736 CTGTAGGTGTAAAAGTGTTGGGG + Intronic
970691532 4:18625851-18625873 TAGAAGGTGATAAAATGTTGTGG - Intergenic
974283371 4:59829929-59829951 ATGTAGGAGTTAAAATGTCGTGG - Intergenic
975742724 4:77445799-77445821 TTGTAGCTGTTCAAATGAACAGG + Intergenic
978054067 4:104240976-104240998 ATGTAGGTCTTCAAATATTTTGG - Intergenic
979797413 4:124863552-124863574 CAGTAGGTATTCAAGTGTTGGGG + Intergenic
979923455 4:126529175-126529197 ATGTAGGTTTTCTACTGTTGGGG + Intergenic
982191167 4:152856682-152856704 TTGTTTGTGTTCAGATGTTAGGG + Intronic
983487317 4:168347376-168347398 TTGTAGGTGGTATAATGTAGGGG + Intergenic
983761996 4:171421867-171421889 TTGTAGGTGTTTAAATTTATTGG + Intergenic
984870707 4:184322605-184322627 TTGTAGGTGATTACATTTTGGGG - Intergenic
985032950 4:185810126-185810148 TTGTAGGGGATAAAATGGTGAGG - Intronic
985809306 5:2071324-2071346 TGGTTGGTTTTCAAATGTTGAGG + Intergenic
986086207 5:4452744-4452766 TTGAAGTTGTTTAAATTTTGGGG - Intergenic
988601097 5:32640170-32640192 CAGCAGGTGTTCAAACGTTGTGG - Intergenic
989088752 5:37706406-37706428 TTGTAGCTCCTCATATGTTGTGG + Intronic
991610629 5:68446203-68446225 TAGTAGGTGTTTAAATGAAGTGG + Intergenic
992608240 5:78483783-78483805 CTGTAGGTGTTCAATTTTTCAGG + Intergenic
993206760 5:84891491-84891513 TTTTAGCTTTTTAAATGTTGGGG + Intergenic
993534046 5:89059121-89059143 TTGTAGGTAAAAAAATGTTGAGG + Intergenic
994720698 5:103376563-103376585 TTGTTGCTGTTGAAAAGTTGGGG + Intergenic
994992316 5:107012638-107012660 TTGTATGTGTTAAAATGTGCGGG - Intergenic
995270883 5:110219007-110219029 TTTTAGGTGTTTAAATATTAGGG + Intergenic
996005705 5:118418806-118418828 TTAGAGGTGTTTAAATGCTGAGG - Intergenic
996318052 5:122183440-122183462 TTATAGGTGTTTTATTGTTGTGG + Intergenic
996591189 5:125149532-125149554 TTGTGGTTCTTCAAATGTGGCGG - Intergenic
998983553 5:147730365-147730387 TTGAGGGTGATCAGATGTTGAGG - Intronic
999803981 5:155065013-155065035 TAGTAGGTGTACCAATGTGGTGG - Intergenic
1000412546 5:160948615-160948637 TTAGAAGTGTTCAAATGGTGGGG + Intergenic
1000926210 5:167197718-167197740 TTGAAGGTGTCCAGATGATGAGG - Intergenic
1002283521 5:178147305-178147327 CTGTAGGTTCTCAAATTTTGGGG + Intronic
1003319790 6:5040757-5040779 TAGTAGGTGTACATATTTTGGGG - Intergenic
1004793402 6:19053782-19053804 ATGTAGGTGCTCCAATGTTGGGG - Intergenic
1005353894 6:24963344-24963366 TTGTAGGGGTTCAAAAAGTGGGG - Intronic
1006123624 6:31822883-31822905 ATTTAGGTGTTTAAAAGTTGGGG - Intergenic
1006593936 6:35179148-35179170 CTGTAGGTGTTTACATGATGTGG - Intergenic
1008151555 6:47958154-47958176 TTGTAGTCTTTCTAATGTTGAGG + Intronic
1010507463 6:76677756-76677778 TTGTGGTTTTTCAAATGCTGTGG - Intergenic
1014379123 6:120716450-120716472 GTGTAGGTCTTGAAATGTTGAGG - Intergenic
1014951394 6:127559688-127559710 ATTTAGGTGCTCAAATGTTGAGG - Intronic
1020391533 7:7662806-7662828 TGGTGAGTGTTAAAATGTTGTGG + Intronic
1023339841 7:39208503-39208525 TTTTAGCTGGTCAAATGTTAGGG + Intronic
1028512041 7:91635934-91635956 TAGTAGGTGTACATATTTTGGGG - Intergenic
1030994126 7:116336997-116337019 TAATAGTTGTTCAAATTTTGGGG + Intronic
1031648878 7:124260840-124260862 TTATAGGCGATCAAAAGTTGAGG + Intergenic
1033957615 7:146870889-146870911 TAGTAGGTGCTCAAATGTTTAGG + Intronic
1034313234 7:150108580-150108602 TGGGAGGTGTTCAAATCATGAGG + Intergenic
1034793627 7:153992087-153992109 TGGGAGGTGTTCAAATCATGAGG - Intronic
1038906667 8:31912063-31912085 TTGTGAGTGTTAAAATGATGTGG + Intronic
1040822793 8:51583402-51583424 TTCTAGGTTATCAAATTTTGGGG + Intronic
1041153992 8:54964639-54964661 TAGTAGTTGTACAAATTTTGGGG + Intergenic
1045097877 8:98817082-98817104 TTTTAGGTGTTGACATGTTCAGG - Intronic
1046868979 8:119183459-119183481 TTGTAAGTCTTGAAATGATGAGG - Intronic
1047022355 8:120788160-120788182 TTTTAGGTGAGCAAATGCTGGGG + Intronic
1048209243 8:132441147-132441169 TTTGAGGTCTTCAAGTGTTGGGG - Intronic
1050348135 9:4713967-4713989 GTGTAGGTGTGTAAATGTGGAGG - Intronic
1051014279 9:12456880-12456902 TTCTAGGTTTTCAATTGTTAAGG - Intergenic
1051612236 9:18972424-18972446 TTGAAGGTGTACAAATGTATTGG - Intronic
1054951775 9:70859788-70859810 TGGCAGCTGTTCAATTGTTGAGG + Intronic
1055207218 9:73746867-73746889 TTGTAGATGCTAAAATGTTAGGG + Intergenic
1055793939 9:79954214-79954236 TTGTAGATGTTCAAATCATGGGG + Intergenic
1058323495 9:103664378-103664400 TTGCAGATATTCAAAAGTTGTGG + Intergenic
1059078086 9:111216542-111216564 TAGTAGGTGTTCACATAATGGGG - Intergenic
1060380284 9:123163836-123163858 ATGTAGGCGTTTAAATTTTGAGG + Intronic
1061686373 9:132283180-132283202 TTGTGGCTGCTGAAATGTTGAGG - Intronic
1186343308 X:8665659-8665681 TTGCAGGTGCTGAGATGTTGGGG + Intronic
1188087527 X:25919146-25919168 TTGTATATGTTGAAATGTAGTGG - Intergenic
1188316129 X:28675918-28675940 TTGTAGGAGTTCAGTTGTTTGGG + Intronic
1192802670 X:74481931-74481953 TTGGTGGTTTTGAAATGTTGTGG - Intronic
1193073063 X:77326910-77326932 TTGTTGGTGTTCAACCATTGTGG - Intergenic
1193501530 X:82281448-82281470 TTGTATGTGTTCCAAAATTGTGG + Intergenic
1193539221 X:82751295-82751317 TTCTAGGTGTTCTACTGATGAGG + Intergenic
1193691462 X:84650069-84650091 TTGTAGGTGTACATATTATGGGG + Intergenic
1196810247 X:119623300-119623322 TTGTAGGTGTGATAATGGTGGGG + Intronic
1197096964 X:122608276-122608298 TTCTAGGTTTTCAAATTTTTTGG - Intergenic
1197325754 X:125091439-125091461 TTTGAGGTGTCCAAATGTAGTGG - Intergenic