ID: 907479666

View in Genome Browser
Species Human (GRCh38)
Location 1:54736800-54736822
Sequence GGTGAGAAAGACGCCCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907479666_907479672 22 Left 907479666 1:54736800-54736822 CCAGCGTGGGCGTCTTTCTCACC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 907479672 1:54736845-54736867 CACTGCTCAACGACCCTACATGG 0: 1
1: 0
2: 0
3: 6
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907479666 Original CRISPR GGTGAGAAAGACGCCCACGC TGG (reversed) Intronic
900982944 1:6056916-6056938 GGTGAGGAAGACACTCACTCAGG - Intronic
901541217 1:9918044-9918066 GGTCAGAAAGATGCCCACAAAGG - Intergenic
907479666 1:54736800-54736822 GGTGAGAAAGACGCCCACGCTGG - Intronic
907479738 1:54737134-54737156 GGTGAGGAAGACGCCTGCACAGG - Intronic
919928183 1:202203677-202203699 AGTGAGAAATACACCCAGGCAGG + Intronic
923728105 1:236524378-236524400 GGTGAGAAAGCAGCCCAGGTGGG - Intronic
924116596 1:240753642-240753664 GGTGAGAAAGACATCAACACAGG - Intergenic
1067282504 10:44883094-44883116 GGTGAGAAAGACCTCCTCGGAGG - Intergenic
1069844559 10:71362097-71362119 GGTGACACAGAAGCCCAGGCTGG - Exonic
1071115803 10:82218600-82218622 GGTGAGAAAAACCCACAGGCTGG - Intronic
1077111938 11:865825-865847 GGTGAGTGAGACCCCCACCCTGG + Exonic
1077286541 11:1768485-1768507 GGTGGGTGGGACGCCCACGCAGG + Intergenic
1088497467 11:110445662-110445684 GCTGGGAAAGAAGCCCAGGCAGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1096452495 12:51756089-51756111 GGTGAGAAGGATGTCCATGCAGG - Intronic
1099365304 12:81759629-81759651 TGTGTGAAAGAAGCCCAGGCGGG - Intergenic
1100521929 12:95383428-95383450 GGTGAGAAAGACGGAGACCCAGG + Intergenic
1102776222 12:115521921-115521943 TGTGAGAAAGGGGCCTACGCAGG + Intergenic
1103839504 12:123850916-123850938 GGTGATGAAGATGCCCATGCGGG - Exonic
1106030543 13:25998315-25998337 GGTGAAAAAGAAGACCAAGCAGG - Intronic
1111253995 13:85641738-85641760 GGTGAGAAATAAGCCCATGTTGG + Intergenic
1111596243 13:90415034-90415056 GGTGAGAGAGAAACCCACACTGG + Intergenic
1113288952 13:108884564-108884586 GATGAGAAAGACGCCGAGACAGG + Intronic
1113820908 13:113211917-113211939 GCTGGGAGAGACGCACACGCTGG - Intronic
1117826589 14:59710577-59710599 GGTGAAAAAGCAGCCCATGCTGG + Intronic
1117883847 14:60338610-60338632 GGTGAGTAAGAGGCTCACTCAGG - Intergenic
1118808881 14:69259902-69259924 GGCGAGACAGACGCCCGCGGCGG - Intronic
1131261527 15:90890415-90890437 GGGGGGAAGGACACCCACGCTGG + Exonic
1132224801 15:100132110-100132132 CGTGAGCAAGACGCCCATCCCGG - Exonic
1132301904 15:100781257-100781279 GGTGAGAAAGAAGCCCTGGAAGG - Intergenic
1150604686 17:66680802-66680824 GGTGGGAAAGGGGCACACGCTGG + Intronic
1150992936 17:70282046-70282068 GATGGGCATGACGCCCACGCTGG + Intergenic
1152035982 17:77873417-77873439 GGTGAAAAGGACGCACACGGAGG + Intergenic
1152320965 17:79608776-79608798 GGTGAGCGAGGCGCCCACGCAGG + Intergenic
1153824632 18:8864268-8864290 GGTGAGAATGAGGCCCAGACAGG + Intergenic
1156716893 18:40022874-40022896 GGTGAGAAAAGAGCCCACCCTGG + Intergenic
1157553098 18:48594807-48594829 GGTGAGGAGGAGGCCCAAGCGGG - Intronic
1162009498 19:7803691-7803713 GCTGAGAAAGACTCCCAGGTGGG + Intergenic
1165463591 19:35959116-35959138 GGGGAGAGTGGCGCCCACGCAGG - Intergenic
1166351495 19:42200661-42200683 GGAGAGAAGGAAGCCTACGCAGG + Intronic
925848084 2:8051884-8051906 GGTGAGAAGGACACCCACATGGG + Intergenic
926144112 2:10386480-10386502 GGGGAGAAAGACCCCCCCCCAGG + Intronic
932326535 2:70865774-70865796 TTTGAGACAGACGCCCAGGCTGG - Intergenic
934567410 2:95348229-95348251 GGGGAGAAAGTGGCCCAGGCTGG + Intronic
938722785 2:134081066-134081088 GGTGAGAATGACTCACACTCAGG - Intergenic
1174043265 20:47714875-47714897 GGTGAGGAAGCAGCCCATGCAGG - Intronic
1174436524 20:50510756-50510778 GGCGAGAAACACGCCCGCCCCGG - Intronic
1175950497 20:62580913-62580935 GGCGGGAAAGGCGCCCTCGCGGG + Intergenic
1179800259 21:43808431-43808453 GGTGAGGAGGGCACCCACGCGGG - Intergenic
1184813499 22:46853237-46853259 GGTGAGAAATATGACCAGGCTGG - Intronic
952817265 3:37456501-37456523 GGTGTGAAAGACGTCCGCTCTGG - Intronic
959690091 3:109189264-109189286 GGTGTGAATGCCACCCACGCAGG + Intergenic
961863971 3:129940106-129940128 GCTGGGAAAGAGGCCCACACAGG - Intergenic
966818230 3:183906210-183906232 GTGGAGAGAGACGCCCACCCAGG + Intergenic
985423063 4:189803482-189803504 GTTGAGAAATACGTCCAGGCCGG - Intergenic
991967637 5:72108161-72108183 GGTGAGGATGAATCCCACGCGGG - Intronic
992212400 5:74493722-74493744 GCTGAGAATGAAGCCCACACTGG - Intergenic
992476083 5:77102874-77102896 GGTGAGAAAGCCAGCCAAGCGGG - Intergenic
995177426 5:109195006-109195028 GGTGGGAAAGACTGCCAGGCTGG - Exonic
996021023 5:118590989-118591011 GGGCAGAAAGAGGCCCGCGCTGG + Intergenic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1000907100 5:166976807-166976829 GCAGAGAAGGACTCCCACGCAGG - Intergenic
1001570835 5:172729609-172729631 GGTGTGGAAGACTCCCACACTGG - Intergenic
1007573244 6:42908371-42908393 GGTGAGAATGATGCCCAATCAGG - Intergenic
1018888855 6:167966139-167966161 GGAGAGAAAGACGCCATCGGAGG - Intronic
1019358224 7:592004-592026 GAAGAGAAAGAGGCCCAGGCAGG + Intronic
1024981691 7:55162589-55162611 GGTGATGAAAACGCCCACGTGGG + Intronic
1029279019 7:99424932-99424954 GGTGAGAAAGAAGAGCAAGCTGG - Exonic
1030783307 7:113627894-113627916 GGTGACCATGACACCCACGCTGG - Intergenic
1031077771 7:117229248-117229270 GCTCAGAAAGGAGCCCACGCTGG + Intronic
1041513414 8:58675359-58675381 GGTGATAAAGACACCCAGGTGGG - Intergenic
1061662240 9:132137881-132137903 GGTGAAAAAGAGGCCCGTGCAGG + Intergenic
1191254022 X:58272112-58272134 GGTGGGACAGACACCCACCCCGG + Intergenic
1191256857 X:58283271-58283293 GGTGGGAGAGACACCCACCCTGG + Intergenic
1197820839 X:130539152-130539174 GGTGAGGAAGGCATCCACGCAGG + Intergenic