ID: 907479738

View in Genome Browser
Species Human (GRCh38)
Location 1:54737134-54737156
Sequence GGTGAGGAAGACGCCTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907479738_907479746 27 Left 907479738 1:54737134-54737156 CCTGTGCAGGCGTCTTCCTCACC 0: 1
1: 0
2: 0
3: 12
4: 167
Right 907479746 1:54737184-54737206 ACATCCTTCTCTCCTTCTTCAGG 0: 1
1: 0
2: 1
3: 44
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907479738 Original CRISPR GGTGAGGAAGACGCCTGCAC AGG (reversed) Intronic
900481229 1:2900419-2900441 GGTGAGCAAGATCCCTGCAGAGG + Intergenic
902955605 1:19922595-19922617 GGTGAGGAAGCAGCCTGCAGGGG - Exonic
903275983 1:22222215-22222237 GGTGGGGGAGATGCCTGCAGGGG - Intergenic
903563795 1:24249162-24249184 GCTGAGGAAGACTCCTCCACTGG - Intergenic
904162473 1:28531894-28531916 GGAGAGGAAGAAGCCGGCCCTGG + Exonic
907479666 1:54736800-54736822 GGTGAGAAAGACGCCCACGCTGG - Intronic
907479738 1:54737134-54737156 GGTGAGGAAGACGCCTGCACAGG - Intronic
910703804 1:90105109-90105131 GGTGAGGAAGGGGCCAGCTCTGG - Intergenic
911523215 1:98953155-98953177 AGTGGGGAAGAGGCCTGTACTGG - Exonic
912518644 1:110230889-110230911 GGTGAGCCTGACGCCTGTACAGG - Intronic
923034567 1:230276573-230276595 TGTCAGGGAGACGCCTGCAGAGG + Intronic
923523550 1:234755372-234755394 GGTGAGGAAGTGGGGTGCACTGG - Intergenic
924288828 1:242516114-242516136 AGTGAGGAAGACACTTGAACAGG - Intronic
1062889074 10:1043544-1043566 GGTGAGGAAGAGCTCTGCACTGG + Intronic
1067023566 10:42823689-42823711 GGTGAGAAAGACACCTGGTCAGG + Exonic
1067144145 10:43681548-43681570 TGTGAGGGAGACACCTGCAATGG - Intergenic
1067527770 10:47048644-47048666 CGAGAGGAAGAGGCCAGCACTGG + Intergenic
1068866966 10:61904070-61904092 GGGGAGGAAGACAGCTGCGCAGG - Intronic
1069211837 10:65771491-65771513 GTTGAGGATGAAGCCTGCAGAGG + Intergenic
1069491706 10:68866809-68866831 GGTGAGGGAGTGGCCTGAACTGG + Intronic
1070361080 10:75689811-75689833 GGGAGGGAAGGCGCCTGCACTGG + Intronic
1072215121 10:93281380-93281402 TGTGAGGAACACGCCTGCCTGGG + Intergenic
1074383105 10:112996118-112996140 GGTGAGGAAGAGGCCAGCTAGGG + Intronic
1076107813 10:127837526-127837548 GGAGAGGAAGAGGGGTGCACTGG - Intergenic
1077834995 11:5918847-5918869 GGTGAGCAAGACGGCTGAACAGG + Intronic
1078801099 11:14644452-14644474 GGTGAGGAAGAAGAAGGCACAGG - Exonic
1081468111 11:43343891-43343913 GGTAATGAAGACACCTGCATTGG - Intronic
1082931903 11:58617384-58617406 GGTGATGAGGGCGCCTGCATTGG - Exonic
1084605289 11:70168613-70168635 AGTCAGGAAGACTCCTGCAGAGG + Intronic
1085048255 11:73365765-73365787 GGTGAGGACGACACCAGCACTGG - Exonic
1087743308 11:101914512-101914534 GGCAAGGAAGACGACTGCAGAGG + Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1089871042 11:121672850-121672872 GGAGAGGAAAACAACTGCACAGG + Intergenic
1091719680 12:2803619-2803641 GATGAGGAAAACGGCTGCCCAGG - Exonic
1092385486 12:8033115-8033137 GGCGAGGAAGACCCCTGTACTGG + Exonic
1096589650 12:52649138-52649160 AGAGAGGAAGAGGCCTGTACAGG - Intronic
1096781361 12:53994187-53994209 GGTGAAGAAGACGGCGGCAGCGG + Intronic
1098036042 12:66302790-66302812 GGTGAGGAAGGCGTCTGCCCGGG + Exonic
1101972569 12:109326174-109326196 GATGAGGAGGATGCCTGGACAGG - Intergenic
1102525449 12:113509293-113509315 GGGGAGGAAGCTGCCTGCAGGGG + Intergenic
1103723653 12:122987494-122987516 GGTCAGGTATATGCCTGCACTGG - Exonic
1106735966 13:32587316-32587338 GTTGAGGAAGAGCCCAGCACTGG + Intronic
1107814852 13:44235259-44235281 GGTGGGGATGACTCCTGCAAAGG + Intergenic
1112630678 13:101158369-101158391 GGGGAGGCAGAGGGCTGCACAGG - Intronic
1113917321 13:113882317-113882339 CTTCAGGAAGAAGCCTGCACAGG + Intergenic
1114068083 14:19083345-19083367 GGTGAGAAAGACACCTGGTCAGG - Intergenic
1114094179 14:19316681-19316703 GGTGAGAAAGACACCTGGTCAGG + Intergenic
1114140410 14:19902743-19902765 GTTGAAGAAGACGCCCGCAATGG - Intergenic
1119199184 14:72740526-72740548 GGTGGGGAAGCCCCCTGCTCAGG - Intronic
1121337481 14:93086165-93086187 GGGGAGGGAGAAGCCTGCTCAGG + Intronic
1122481532 14:102050463-102050485 GGTGAAGATGAGGTCTGCACGGG - Exonic
1123108686 14:105855173-105855195 GGTGAGGAAGATGCTGGCAAAGG + Intergenic
1123424709 15:20160731-20160753 GGTGAGAAAGACACCTGGTCAGG + Intergenic
1123533933 15:21167262-21167284 GGTGAGAAAGACACCTGGTCAGG + Intergenic
1128233187 15:66049535-66049557 GGTGGGGAAAACGCTTCCACAGG - Intronic
1128878601 15:71222719-71222741 GGTGAGGAAAACTCTTGCCCAGG + Intronic
1129157745 15:73729216-73729238 GGTGATTATGACACCTGCACAGG - Intergenic
1130010515 15:80149858-80149880 GGTGTGGACGCTGCCTGCACTGG - Intergenic
1132936522 16:2484042-2484064 GGGGTGGGAGATGCCTGCACAGG - Intronic
1136860147 16:33695013-33695035 GGTGAGAAAGACACCTGGTCAGG - Intergenic
1138561199 16:57802014-57802036 GGTGGGGAAGACGCCAGGAAGGG + Intronic
1141448575 16:84080731-84080753 GGGGAGGAAGAGGCTCGCACAGG - Intronic
1141610437 16:85178176-85178198 GGTGAGAAACAGGCGTGCACAGG + Intronic
1142410814 16:89915704-89915726 GGGAAGGAAGACGGCTCCACTGG - Intronic
1144456953 17:15426636-15426658 GATGATGATGACGCCTGCATGGG + Intergenic
1147565986 17:41536715-41536737 GATGAGCAAGACCCCTCCACAGG + Intergenic
1148757473 17:49981118-49981140 GGGGTGGAAGAAGCCTGCATTGG - Intergenic
1150370278 17:64631561-64631583 GGTGAGGAACACACCTTGACTGG + Intronic
1151288795 17:73133481-73133503 GGTGAGCAAGACGCCTCCTGTGG + Intergenic
1152400990 17:80066018-80066040 GGGGAGGAAGAGGCCTCCTCTGG + Intronic
1152599071 17:81252450-81252472 GGTTGGGAAGAGGCCTGGACAGG - Exonic
1156419397 18:36934184-36934206 AGGGAGGAAGCTGCCTGCACAGG - Intronic
1157288363 18:46392784-46392806 TGTGAGGAACACGCATGCAGTGG + Intronic
1159632275 18:70762865-70762887 AGTGAGGAGGCCGCTTGCACAGG + Intergenic
1160942505 19:1627004-1627026 GGTGAGGATCTCGGCTGCACAGG + Intronic
1162021429 19:7870134-7870156 GGTGAGAAAGGGGCCTGCCCAGG + Exonic
1162021561 19:7870542-7870564 GGAGAGAAAGGGGCCTGCACTGG + Exonic
1162021836 19:7871634-7871656 GGAGAGGGAGAGGCCTGCAGAGG + Exonic
1163604011 19:18264440-18264462 GGTGACTAAGACGCCGGCCCTGG - Exonic
1165190135 19:34056293-34056315 GGTGAGGAAGACGTTTGCAGAGG + Intergenic
1165350613 19:35273117-35273139 GGTGATGAAGACTGCTTCACAGG - Intronic
1166720589 19:44993805-44993827 AGTGAGGAAGAGGCCTGGCCTGG - Intergenic
1166737994 19:45097442-45097464 GCTGAAGGAGACCCCTGCACTGG - Intronic
1167166845 19:47804403-47804425 GGACAGGAAGCCGCCCGCACAGG + Intronic
1167174991 19:47859361-47859383 GGACAGGAAGCCGCCCGCACAGG - Intergenic
1168400787 19:56085182-56085204 GGAGAGGAAGCAGCCTGCCCAGG - Intergenic
925611994 2:5709362-5709384 GGTGAGCAAGTCGCCAGCCCAGG + Intergenic
926984519 2:18607652-18607674 GGACAGGAAGAGGCCTGCAAAGG + Intergenic
928632471 2:33208194-33208216 GGTGAGGATGGCACCTGCATGGG + Intronic
929775574 2:44929076-44929098 GGTGAGGAGGACGCCAGGAAGGG - Intergenic
931417520 2:62095121-62095143 GGTAATGAAGACACCTGCATTGG + Intronic
932097448 2:68864101-68864123 GGTGAGGAAGTGTTCTGCACAGG - Intergenic
934458510 2:94196128-94196150 GGTGAGAAAGACACCTGGTCAGG - Intergenic
937076426 2:119110609-119110631 GGTAAGTAAGATGCCTGCACAGG + Intergenic
937236439 2:120434186-120434208 GGTGAGAACCAAGCCTGCACTGG - Intergenic
945942941 2:215967926-215967948 TTTGAGGAAGATGCATGCACTGG - Intronic
946135540 2:217643968-217643990 CGTGAGTAAGACCCCTGCCCTGG - Intronic
947544271 2:231000322-231000344 GGTGAGGGAGGCACCTGCCCTGG - Intronic
948757547 2:240168206-240168228 GGCAAGGAAGGGGCCTGCACGGG + Intergenic
1171488948 20:25503272-25503294 GGTGAGGAACATGGCTGCTCAGG - Intronic
1171488961 20:25503330-25503352 GGTGAGGAACATGGCTGCTCAGG - Intronic
1173020742 20:39265753-39265775 GGTCAGGAAGACACATGCATAGG - Intergenic
1175403773 20:58714582-58714604 GGCGATGAAGAGGCCAGCACAGG - Exonic
1175751973 20:61504852-61504874 GGTGATGAGGACGCGTGTACGGG - Intronic
1178636285 21:34307067-34307089 GGGGAGGAAGACAGGTGCACAGG - Intergenic
1180486556 22:15805909-15805931 GGTGAGAAAGACACCTGGTCAGG - Intergenic
1180703635 22:17795444-17795466 GAAGAGGCAGGCGCCTGCACGGG + Intronic
1181125965 22:20702709-20702731 GGTGAGGAAGAGTCCTGGAATGG + Intergenic
1181239302 22:21468017-21468039 GGTGAGGAAGAGTCCTGGAATGG + Intergenic
1181357696 22:22310306-22310328 GGTGAGAAAGACACCTGGTCAGG + Intergenic
1181412140 22:22731388-22731410 GGTGAGGAATGAGCCTGCATCGG + Intergenic
1182894501 22:33848268-33848290 GGTGAGGAAGACTGTTGCAGTGG - Intronic
1183346142 22:37309481-37309503 GGGCAGGCAGACGGCTGCACTGG - Intronic
1183977822 22:41523450-41523472 GGTGAGGAAGGGCCCTGCAGAGG + Intronic
1185182153 22:49369726-49369748 GGTGAGGCAGGGGCCTGCACTGG + Intergenic
949901145 3:8815688-8815710 TGTGATGAAGACTCCTGCCCTGG + Intronic
952389598 3:32868848-32868870 GGTGAGGACTATGCCTGAACTGG + Intronic
959157142 3:102680391-102680413 GGTGAGGAACAGAACTGCACAGG - Intergenic
962758523 3:138486687-138486709 GGTGGGGAAAACCCCTGCCCTGG - Intergenic
963837003 3:150067934-150067956 GGTGAGGAAGTAGCATGGACAGG + Intergenic
965560726 3:170059968-170059990 GGTGAGGAAGACTCCTGAGATGG + Intronic
966878383 3:184336223-184336245 GGAGAGGGAGGAGCCTGCACCGG + Intronic
967982900 3:195076306-195076328 AGAGAGGAAGAAGCCCGCACGGG + Intronic
968135094 3:196215243-196215265 GGGAAGGAAGAGGCCTGCAAGGG - Intronic
968558262 4:1261426-1261448 GGTGAGGAAGAAGCCTGGGGTGG + Intergenic
969336827 4:6515846-6515868 GGTGAGGAAGAATCCTCCCCTGG - Intronic
972160568 4:36221468-36221490 GGTGAGGAACAAGACTGCCCAGG - Intronic
980883930 4:138741531-138741553 GGTGAGGAGGTGGCCTCCACTGG - Intergenic
987388240 5:17350692-17350714 GGTGGGGAAGAAGGCTACACAGG - Intergenic
989490879 5:42051521-42051543 GGTGAGTAAGACACTTGCTCAGG + Intergenic
990000578 5:50886849-50886871 GGTAAGGAAGACTCCTGCTGAGG + Intergenic
992396314 5:76372444-76372466 CGTGGGGAAGGCACCTGCACAGG - Intergenic
992753918 5:79886542-79886564 GGTGAGGAAGAGGTCTGTAATGG - Intergenic
992955282 5:81901779-81901801 GGTGCAGAAGAGGCCTGCAGAGG + Intergenic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1001570835 5:172729609-172729631 GGTGTGGAAGACTCCCACACTGG - Intergenic
1003307992 6:4946387-4946409 GGTGAGGAAAATGCCCCCACTGG - Intronic
1004258351 6:14085538-14085560 GGGGAGGAAGAAGCCTGTAGGGG - Intergenic
1004479330 6:16003863-16003885 AGTGAGGAACATGCGTGCACAGG - Intergenic
1006302489 6:33200968-33200990 GGTGAGGAAAAGGCCTGGAAAGG - Exonic
1008483365 6:52009222-52009244 GGTGAGGGAGAAGCCTGCAGAGG + Intronic
1008592753 6:53010376-53010398 GGTGAGGGAGATGGCGGCACAGG - Intronic
1008767456 6:54936033-54936055 GATGAGGAAGAGGTCAGCACTGG + Intronic
1016144747 6:140655957-140655979 GGTCAGGAAGCTGCCAGCACAGG - Intergenic
1019941830 7:4298065-4298087 GGTCAGGAAGATGCCTGAGCTGG + Intergenic
1023936851 7:44746653-44746675 GGTGAGAGAGATGCCTGCCCTGG + Intergenic
1027360922 7:77408896-77408918 GGTGAGCTGGACACCTGCACTGG + Intronic
1029201237 7:98840500-98840522 GGTCAGAAAGATGCCTGCAGAGG + Intergenic
1032202766 7:129834471-129834493 GGGGAGGAAGAGGCCTGCTGTGG - Exonic
1034316384 7:150137112-150137134 TGTGAGGAACAGGGCTGCACAGG - Intergenic
1034790478 7:153963565-153963587 TGTGAGGAACAGGGCTGCACAGG + Intronic
1034810131 7:154124455-154124477 GGACAGGAAGCAGCCTGCACCGG + Intronic
1034871481 7:154688645-154688667 GGGCAGGAAGAGGCCAGCACTGG + Intronic
1035216592 7:157372296-157372318 AGTGAGGACGAGGCCTGCACAGG + Intronic
1035602326 8:903963-903985 GGTGAGGAAGAGGCGTGGCCGGG + Intergenic
1035770756 8:2144975-2144997 GGCTAGGAAAACGCCTTCACTGG - Exonic
1036751476 8:11446231-11446253 GCTGAGGAAAACGTCTGGACTGG - Intronic
1037485036 8:19339144-19339166 GGTGAGGAAGCATCCAGCACAGG + Intronic
1038282461 8:26178331-26178353 GGTGTGGGAGAAGACTGCACAGG + Intergenic
1038704829 8:29883962-29883984 TTTGTGGAAGATGCCTGCACAGG + Intergenic
1040550767 8:48435579-48435601 TGTCAGAAAGACACCTGCACTGG + Intergenic
1048374251 8:133808811-133808833 GGGGATGAAGAACCCTGCACAGG + Intergenic
1049802536 8:144524751-144524773 GGAGAGGAAGACCCCCGCAACGG - Exonic
1053689014 9:40571944-40571966 GGTGAGAAAGACACCTGGTCAGG - Intergenic
1054275020 9:63059122-63059144 GGTGAGAAAGACACCTGGTCAGG + Intergenic
1054300257 9:63372876-63372898 GGTGAGAAAGACACCTGGTCAGG - Intergenic
1054399809 9:64705807-64705829 GGTGAGAAAGACACCTGGTCAGG - Intergenic
1054433395 9:65190068-65190090 GGTGAGAAAGACACCTGGTCAGG - Intergenic
1054496990 9:65831601-65831623 GGTGAGAAAGACACCTGGTCAGG + Intergenic
1055349227 9:75368512-75368534 GGAGAGGAAAACACCTGCTCTGG + Intergenic
1057204767 9:93164567-93164589 GGGCAGGAAGACGCCAGCCCCGG + Intergenic
1059605557 9:115831143-115831165 GGTGAGGAGGACTTCTGCATTGG - Intergenic
1060893455 9:127202800-127202822 GGTGAGGAAGACTGCTGACCAGG - Intronic
1061621652 9:131814650-131814672 GGTGGGGGAGACCCCTGCCCTGG + Intergenic
1062035843 9:134382189-134382211 GGGGAGGCAGACGCCAGCCCAGG - Intronic
1062291525 9:135797422-135797444 GGTGAGGAAGAGGACGGCATGGG - Intergenic
1062656025 9:137605069-137605091 GGTGAGGGAGACCCCTGGGCGGG + Intergenic
1190302444 X:49064633-49064655 GCTGAGCAAGACGCATGCCCAGG - Exonic
1195769898 X:108339477-108339499 GGTGAGGGTGAGGCCTGAACTGG - Intronic
1196477427 X:116104985-116105007 GGTAATGAAGACACCTGCATTGG + Intergenic