ID: 907485841

View in Genome Browser
Species Human (GRCh38)
Location 1:54777531-54777553
Sequence CCGTGATGAGCAAGTTATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907485841_907485846 11 Left 907485841 1:54777531-54777553 CCAGTATAACTTGCTCATCACGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 907485846 1:54777565-54777587 AGCTCCTAAAGGCAAGGACAGGG 0: 1
1: 0
2: 2
3: 32
4: 357
907485841_907485843 0 Left 907485841 1:54777531-54777553 CCAGTATAACTTGCTCATCACGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 907485843 1:54777554-54777576 TCTAGACTGTGAGCTCCTAAAGG 0: 1
1: 3
2: 31
3: 194
4: 839
907485841_907485845 10 Left 907485841 1:54777531-54777553 CCAGTATAACTTGCTCATCACGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 907485845 1:54777564-54777586 GAGCTCCTAAAGGCAAGGACAGG 0: 1
1: 0
2: 2
3: 28
4: 217
907485841_907485844 5 Left 907485841 1:54777531-54777553 CCAGTATAACTTGCTCATCACGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 907485844 1:54777559-54777581 ACTGTGAGCTCCTAAAGGCAAGG 0: 1
1: 0
2: 17
3: 95
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907485841 Original CRISPR CCGTGATGAGCAAGTTATAC TGG (reversed) Intergenic
900811368 1:4803773-4803795 CCCTGAAGAGTAAGTTATACTGG - Intergenic
907483602 1:54761320-54761342 CAGTGGTGAGCAAGCTAGACAGG - Intronic
907485841 1:54777531-54777553 CCGTGATGAGCAAGTTATACTGG - Intergenic
908831403 1:68182359-68182381 CCGTTGTGAGCATGTTATATTGG - Intronic
913158929 1:116128201-116128223 CCGTGCTGAGCAGGTGTTACTGG + Exonic
914480146 1:148058986-148059008 CTGTGATGACCAAGTCACACTGG - Intergenic
921897590 1:220416470-220416492 CTGTGTTGAGCAAGTTCTATTGG + Intergenic
923207650 1:231774379-231774401 CTGCGATAAGGAAGTTATACAGG + Intronic
1070280444 10:75044365-75044387 CCCTGATGAACAGGTTATTCTGG - Intronic
1071920075 10:90339886-90339908 ACGTTGTGAGCAAGTTCTACAGG + Intergenic
1088490482 11:110382499-110382521 CCTTGATGAGTTAGTTATAATGG + Intergenic
1102576807 12:113860819-113860841 CAGTGATGAGCAAGATAGATGGG - Intronic
1104283855 12:127405175-127405197 CAGTGATCAGCAAGTTAGATGGG + Intergenic
1112001985 13:95219299-95219321 CAGAGATGAGCAAGACATACTGG + Intronic
1122395475 14:101425736-101425758 TGGTTATGAGCAAGTTATAAGGG + Intergenic
1132438321 15:101831832-101831854 CTGAGATAAGGAAGTTATACAGG - Intergenic
1139757957 16:69160224-69160246 CAGTGATCAGCAAATTATCCTGG + Intronic
1153341185 18:3976809-3976831 ACGTTATCAGCAAGTTATAAAGG + Intronic
1159344554 18:67183430-67183452 TGGTTATGAGCTAGTTATACGGG + Intergenic
1168545563 19:57246940-57246962 CTGTGCTGAGTAAGTTAAACTGG - Intronic
932617154 2:73240200-73240222 CCTTGAAGAGCAATTAATACAGG - Intronic
935808617 2:106773438-106773460 CTGGGATGAGCAAATTCTACTGG + Intergenic
1170233263 20:14073641-14073663 CCGTGATAGGTAAGCTATACAGG + Intronic
1170286652 20:14717280-14717302 CAGTCATCAGCAGGTTATACAGG + Intronic
1170579472 20:17686997-17687019 CTGTGATCAGCAAGCTATAAGGG + Intergenic
1178862134 21:36298292-36298314 CAGTGCTGAGAAAGTTAAACAGG + Intergenic
1182148809 22:28014259-28014281 GCGCGATGAGCAGGTCATACAGG + Exonic
953807355 3:46082229-46082251 TCATGAAGAACAAGTTATACAGG - Intergenic
955065518 3:55530765-55530787 CAGTGATGAGCAAGTGACAGTGG - Intronic
967283648 3:187847772-187847794 CTGTGATAAGAAAGTTCTACTGG + Intergenic
971717769 4:30202133-30202155 CCTTGATGAGTAAGTAATGCTGG + Intergenic
977828054 4:101556859-101556881 CCAAGATGAGCAATTTATAAAGG + Intronic
983929344 4:173435931-173435953 TTGTGATGACCAAGTTATAAAGG - Intergenic
985940232 5:3129336-3129358 CTGTGTTGAGTAAGTTATTCTGG + Intergenic
990633252 5:57694035-57694057 CAGTCATGAGCAAGTAAAACTGG + Intergenic
995600655 5:113791702-113791724 CCGTGAAAAGCAAGTCATAGAGG - Intergenic
1001430778 5:171660350-171660372 CTGTGATGATCAAGTTGTCCAGG + Intergenic
1008199647 6:48570560-48570582 CCTTGCTGAGTAAGCTATACTGG + Intergenic
1008477234 6:51945267-51945289 CCTTGATGAGCAAGTGGTAAAGG + Intronic
1020353353 7:7249017-7249039 CAGTGGTGAGCAAGACATACAGG + Intergenic
1030905729 7:115179794-115179816 CCGTGTTGAGAAATTTTTACAGG - Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1196335953 X:114534614-114534636 CTTTGATGAGCAAATTTTACAGG + Intergenic