ID: 907486673

View in Genome Browser
Species Human (GRCh38)
Location 1:54782688-54782710
Sequence TACTCACTCATTGCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907486673 Original CRISPR TACTCACTCATTGCACAGAC AGG (reversed) Intronic
901880974 1:12193541-12193563 ACCTCACTCATTGCCCAGGCTGG - Intronic
903285564 1:22274836-22274858 AACTCACTCATTTAACAGATAGG + Intergenic
904136163 1:28314206-28314228 TGCTGCCTCAATGCACAGACAGG - Intergenic
904205445 1:28851823-28851845 TTCTCTCTCATTGCCCAGGCTGG - Intronic
904628052 1:31819451-31819473 TTCTCTCTCATTGCCCAGGCTGG + Intergenic
905575851 1:39044052-39044074 GTCTCGCTCATTGCCCAGACTGG - Intergenic
906573041 1:46861477-46861499 TACTCACCTCTTCCACAGACAGG + Intergenic
907072560 1:51549927-51549949 CACTCACTCATTCCACAGCCTGG + Intergenic
907194085 1:52672460-52672482 TACTCTGTCCTTGCTCAGACTGG + Intergenic
907430914 1:54410737-54410759 AACATACTCATTGCACAGAGAGG - Intronic
907486673 1:54782688-54782710 TACTCACTCATTGCACAGACAGG - Intronic
908255614 1:62301221-62301243 AACTCTCTCATTTCACAGATGGG + Intronic
908765950 1:67554793-67554815 TTCTCTCTCGTTGCCCAGACTGG - Intergenic
911741979 1:101395982-101396004 GTCTCACTTATTGCCCAGACTGG - Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
916104060 1:161417979-161418001 GTCTCACTCATTGCCCAGGCTGG - Intergenic
917173689 1:172207059-172207081 TACCCACTCATTACACATTCTGG + Intronic
917226991 1:172794798-172794820 GTCTCACTTATTGCACAGACTGG + Intergenic
917809623 1:178645712-178645734 TGCTGCCTCATTCCACAGACGGG + Intergenic
920079449 1:203361769-203361791 GCCTCAATCATGGCACAGACAGG - Intergenic
920123100 1:203673404-203673426 TGTTCACATATTGCACAGACAGG - Intronic
920384766 1:205563238-205563260 TTCTCACTGATTTCACAGCCTGG + Intergenic
920613886 1:207470087-207470109 CACTCACCCTTTTCACAGACTGG - Exonic
921358448 1:214308070-214308092 TGCTCACTCAATTCCCAGACAGG + Intronic
921815415 1:219557682-219557704 TAAAGACTCATTGCACAGGCTGG + Intergenic
922158199 1:223056613-223056635 TTCACTCTCATTGCCCAGACTGG - Intergenic
923118602 1:230968736-230968758 TCTTCCCTCATTGCACAAACTGG - Intronic
924520730 1:244803866-244803888 GTCTCACTCATTGCCCAGGCTGG + Intergenic
1063687468 10:8251207-8251229 TACTCTCTGATTGTAAAGACTGG + Intergenic
1063824172 10:9875561-9875583 CACTCACTCTGTGCACAGATTGG + Intergenic
1064937358 10:20692925-20692947 TACTCACAAATAGCACAGCCAGG - Intergenic
1065226654 10:23550297-23550319 TTCGCACTCATTGCCCAGGCTGG + Intergenic
1068879692 10:62035518-62035540 GTCTCACTCATTGCCCAGGCTGG + Intronic
1069778515 10:70940745-70940767 CCCTCCCCCATTGCACAGACAGG - Intergenic
1069913589 10:71773925-71773947 TACTCACTCATTCCACAGCTGGG - Intronic
1071297886 10:84235638-84235660 GTCTCACTCATTGCCCAGGCTGG + Intronic
1075086190 10:119415866-119415888 AACCCACTCATGGCACAGATGGG - Intronic
1075521414 10:123145891-123145913 TATTCACTCAATGTACAGGCCGG - Intergenic
1075568427 10:123521106-123521128 GACCCATTCATTGCACAGAGGGG + Intergenic
1078683279 11:13501192-13501214 CAGTAACTCATTGCACAGAGGGG - Intergenic
1082773764 11:57230096-57230118 TACTTTCTCATTGAACAGAGGGG - Intergenic
1082871434 11:57946446-57946468 TTCTCTCTCATTGCCCAGGCTGG + Intergenic
1085286021 11:75361500-75361522 GTCTCACTCATTGCCCAGGCTGG - Intergenic
1087223039 11:95567176-95567198 TTCTCACTATTTGCACAGGCTGG + Intergenic
1088618729 11:111660491-111660513 TCCTCACTCATAGCACAAAGTGG - Intronic
1090598601 11:128346193-128346215 TACTTACTAAATGCACAGACTGG - Intergenic
1090739090 11:129640911-129640933 CACTCACTCATTTCACAGATGGG - Intergenic
1092647515 12:10592423-10592445 TTCTCACTCATCGAACAGATGGG - Intergenic
1098876805 12:75874138-75874160 TTCTCTCTCATTGCCCAGGCTGG + Intergenic
1100552328 12:95656580-95656602 GTCTCACTCATTGCCCAGGCTGG + Intergenic
1101249963 12:102923369-102923391 TAATCACACATTGCACAGTTTGG + Intronic
1104233824 12:126911993-126912015 TTCTCTCTCGTTGCCCAGACTGG - Intergenic
1104365729 12:128174916-128174938 TACTCATCCATTTCACAGATGGG + Intergenic
1106725807 13:32484511-32484533 TCCACTCTCATTGCCCAGACTGG + Intronic
1107332282 13:39314009-39314031 TACTACCCCATTTCACAGACAGG + Intergenic
1108509162 13:51139283-51139305 ATCTCACTCATTGCCCAGGCTGG - Intergenic
1112763430 13:102715860-102715882 TTCACTCTCATTGCACAGGCTGG + Intergenic
1113641773 13:111962812-111962834 CACACACACAGTGCACAGACGGG + Intergenic
1120561581 14:86000703-86000725 GACTCACTCTTTGTCCAGACTGG + Intergenic
1120955325 14:90077147-90077169 TTCTCTCTCATTGCCCAGGCTGG + Intronic
1121934571 14:98005580-98005602 TAGTCACTCATTACAAAAACTGG - Intergenic
1122078232 14:99249141-99249163 AAATCACTCATTGCCCAGCCAGG + Intronic
1122220175 14:100233319-100233341 GTCTCACTCATTGCCCAGGCTGG - Intergenic
1126785687 15:52176346-52176368 TGCTCGCTCATCGCACAGATGGG + Intronic
1127412888 15:58727034-58727056 GTCTCACTCATTGCCCAGGCTGG + Intronic
1128095407 15:64950159-64950181 AACACCCTCATTGCACAGATGGG - Intronic
1128885950 15:71288424-71288446 AACTCTCTCATTGTACAGATGGG + Intronic
1129606842 15:77029145-77029167 ACATCACTCATTGCACAGACAGG + Intronic
1129942958 15:79514104-79514126 TCCTCACTCCTTGAACAGATGGG - Intergenic
1130888635 15:88114576-88114598 TACTAACTCATCTCAAAGACAGG + Intronic
1132476845 16:143637-143659 TCCACACTCACTGCACAGGCTGG + Intergenic
1137248951 16:46729309-46729331 GACCCACTCATCTCACAGACAGG + Intronic
1138466456 16:57195480-57195502 TCCACTCTCATTGCCCAGACTGG - Intronic
1140817942 16:78637994-78638016 AACTCAAACACTGCACAGACAGG - Intronic
1140867160 16:79073207-79073229 TACTCTCTCTTTGCCCAGGCTGG + Intronic
1141370019 16:83478334-83478356 TACTCACCCAGTGCCCATACAGG - Intronic
1142886987 17:2919082-2919104 TCCTTATTCATTCCACAGACAGG - Intronic
1143158189 17:4852282-4852304 TATTCATTCATTCCACAGACAGG + Intronic
1143299298 17:5897842-5897864 GAGTCACACATTGCAGAGACAGG + Intronic
1144008201 17:11120340-11120362 ATCTCACTCATCGCCCAGACTGG - Intergenic
1144822378 17:18084542-18084564 TTCTCTCTTATTGCACAGGCTGG + Intergenic
1145019503 17:19418383-19418405 TCCCCACTCTTTGCACAGATGGG + Intergenic
1150854008 17:68733246-68733268 TACTCAGTCCTTGAACTGACTGG - Intergenic
1151205525 17:72503725-72503747 TACTATCCCATTGCACAGATGGG + Intergenic
1152328090 17:79654166-79654188 CACTCATTCATTGCACAGACTGG + Intergenic
1154256493 18:12785149-12785171 TTTTCACTCATTGCCCAGGCTGG + Intergenic
1155444268 18:25894487-25894509 TTCTCTCTCATTGCCCAGGCTGG + Intergenic
1155569000 18:27169632-27169654 GTCTCACTCATTGCCCAGGCTGG + Intronic
1156652550 18:39241599-39241621 TACTGACTCATTTCACATAGTGG - Intergenic
1160884816 19:1340936-1340958 TCCTCTCTCAAAGCACAGACAGG - Intergenic
1165382474 19:35490846-35490868 CTCTCACTCGTTGCCCAGACTGG + Intronic
1166673672 19:44726303-44726325 GTCTCACTCATTGCCCAGGCTGG + Intergenic
1168426171 19:56240765-56240787 GTCTCACTCATTGCCCAGGCTGG + Intronic
925232618 2:2247777-2247799 TACTGACTCATTGGACATTCAGG - Intronic
926420033 2:12686929-12686951 TACTCATTCATTCAACAAACTGG - Intergenic
927595614 2:24394377-24394399 GTCTCACTCTTTGCCCAGACTGG + Intergenic
928147266 2:28790249-28790271 TTCACACCCATTGCACAGGCAGG - Intronic
929645048 2:43617915-43617937 GTCTCACTCATTGCCCAGGCTGG + Intergenic
929678461 2:43963412-43963434 TTCTCTCTCATTGCCCAGGCAGG - Intronic
930402701 2:50910763-50910785 TATTCAGTCATTGCGCACACTGG - Intronic
932273132 2:70428706-70428728 GTCTCGCTCATTGCACAGGCTGG + Intergenic
935549835 2:104441285-104441307 AACTCACTCATTCCACACAACGG - Intergenic
935694119 2:105756401-105756423 TAGTAATTCTTTGCACAGACTGG + Intronic
935703730 2:105837869-105837891 TACACAGTCATTGCAAGGACAGG - Intronic
936747937 2:115602700-115602722 GGCTCACTCATGGCACAGCCTGG + Intronic
937310246 2:120897755-120897777 AACCCACTCATTGTACAGAAAGG - Intronic
937577459 2:123441289-123441311 TACTGACTCATAGCACAGTAGGG + Intergenic
939993893 2:148902148-148902170 TGCACAGTCACTGCACAGACAGG - Intronic
947307763 2:228765922-228765944 TACTCACTTACTGCTGAGACAGG - Intergenic
1170797010 20:19556736-19556758 TTCTCTCTTAATGCACAGACAGG + Intronic
1170854700 20:20040417-20040439 TACTAAATCTTTCCACAGACTGG - Intronic
1172317379 20:33966659-33966681 GTCTCACTCATTGCTCAGGCTGG - Intergenic
1172791550 20:37509338-37509360 AACTACCTCATTTCACAGACGGG + Intronic
1173067091 20:39723371-39723393 TTCCCACACATTGCACAGTCAGG - Intergenic
1173991535 20:47307426-47307448 TTCTCTCTCATTGCCCAGGCTGG - Intronic
1174613582 20:51818968-51818990 TTCACTCTCATTGCCCAGACTGG + Intergenic
1177383115 21:20371138-20371160 GTCTCACTCATTGCCCAGGCTGG - Intergenic
1178050912 21:28746350-28746372 TTCTGACTCACTGCAAAGACAGG - Intergenic
1178924102 21:36760935-36760957 TACCCACACATGGCACAGCCTGG - Intronic
1179562832 21:42227622-42227644 TACTCACTGCTTGCAAACACTGG - Intronic
1180626007 22:17193977-17193999 AACTCACTCATTGCCCAGGCTGG - Intronic
1180843234 22:18968960-18968982 TCATCACCCATTGCACAGATGGG - Intergenic
1181058235 22:20269775-20269797 TCATCACCCATTGCACAGATAGG + Intronic
1183478742 22:38051224-38051246 TATTCATTCATTTAACAGACAGG + Intergenic
1184266619 22:43350447-43350469 TGCTCAATCATTGCACGGAGGGG + Intergenic
950856292 3:16108716-16108738 TACTCACTCACTCTACAGAATGG - Intergenic
952832591 3:37577327-37577349 TATTCACTCAATGCCCAGCCAGG - Intronic
953045265 3:39289122-39289144 GTCTCACTCATTGCCCAGGCTGG - Intergenic
953201695 3:40783529-40783551 TCCTCACTCAATTCACAGGCAGG + Intergenic
954182800 3:48894845-48894867 GTTTCACTCATTGCCCAGACTGG + Intronic
954437047 3:50501975-50501997 GTCTCTCTCATTGCACAGCCTGG - Intronic
954841646 3:53516677-53516699 TACTAGTTCATTGCACAGAGGGG - Intronic
957393056 3:79603663-79603685 TATTTACTCAAAGCACAGACAGG - Intronic
960945747 3:122965277-122965299 AACTCCCACATTGCACAGAGTGG + Intronic
962048223 3:131784157-131784179 AACTCAATCATTGGTCAGACAGG - Intronic
962370889 3:134819997-134820019 TTCTCACTCATATCACAGTCTGG + Intronic
962875141 3:139530334-139530356 TACTCTCCCATTTTACAGACAGG - Intronic
963749278 3:149159046-149159068 TACTTTCTCATTATACAGACAGG + Intronic
965625387 3:170679261-170679283 TGCTCACTCATGGCACTGGCTGG + Intronic
967160544 3:186733644-186733666 CAGTCACTCATTTTACAGACGGG - Intronic
969181724 4:5446957-5446979 AACCCACTCATTGTACAGATGGG + Intronic
969938255 4:10704737-10704759 TACTCCCTGATTCCACAGCCAGG - Intergenic
971102341 4:23481660-23481682 TATCCACACATTACACAGACAGG + Intergenic
973981278 4:56310239-56310261 TTCTCACTCATTGCTTAGATGGG + Intronic
975574526 4:75849612-75849634 CACCCACTCATTGCAGTGACTGG - Intergenic
978807801 4:112818695-112818717 TACTCACCCAATGCAGAGAAGGG - Intronic
980965778 4:139519384-139519406 TACTTACTCATTTTACAGATAGG - Intronic
982272774 4:153608089-153608111 GTCTCACTCATTGCCCAGGCTGG - Intronic
982407079 4:155032738-155032760 TCTTCATTCATTGCACAAACAGG - Intergenic
983325265 4:166246638-166246660 AACTCACTGTTTACACAGACTGG - Intergenic
985447688 4:190034814-190034836 TTTTCACTCATTGTACAGGCAGG - Intergenic
987932416 5:24419193-24419215 TCCTCACTAATTGCCCAGGCTGG + Intergenic
988664893 5:33315652-33315674 TACACATTCAGTGCTCAGACAGG - Intergenic
988805472 5:34736370-34736392 GTCTCACTCATTGCCCAGGCTGG - Intronic
990527609 5:56643279-56643301 GTCTCACTCATTGCCCAGGCTGG - Intergenic
992724221 5:79590292-79590314 GACTCACTCATTGCCCAGGCTGG - Intergenic
993620523 5:90162599-90162621 TTCTCACTCACTTCAAAGACAGG + Intergenic
1000511861 5:162192594-162192616 TTCTCAGGCATTGCACAGAAAGG + Intergenic
1001356526 5:171030588-171030610 TACTCATACAATGCACATACAGG - Intronic
1006815968 6:36850135-36850157 TACTTCCTCATTACACTGACGGG - Intergenic
1006895378 6:37465235-37465257 GTCTCACTCATTGCCCAGGCTGG - Intronic
1009480657 6:64154408-64154430 TTCCCACTTATTGCCCAGACTGG - Intronic
1012906287 6:105070011-105070033 TACTCACTCATGCCTCAGAAAGG - Intronic
1017005574 6:150026067-150026089 TTCTCTCTTATTGCACAGGCTGG + Intergenic
1020075549 7:5255869-5255891 GTCTCACTCATTGCCCAGGCTGG - Intergenic
1021498052 7:21297913-21297935 TTCACACTTATTGCCCAGACTGG - Intergenic
1024928478 7:54643460-54643482 TACTCACTCATTCAAATGACTGG - Intergenic
1025203526 7:56977694-56977716 GTCTCACTCATTGCCCAGGCTGG + Intergenic
1025668417 7:63599234-63599256 GTCTCACTCATTGCCCAGGCTGG - Intergenic
1026399808 7:69998216-69998238 TACTCACTTTTTCCACAGATGGG + Intronic
1027392891 7:77723496-77723518 GTCTCACTCTTTGCCCAGACTGG + Intronic
1029349454 7:100002962-100002984 TTCTCTCTTATTGCCCAGACTGG + Intergenic
1029443797 7:100602147-100602169 TACTCCCTCACTGGACAGAGTGG + Intergenic
1031331311 7:120468261-120468283 TACATACTCATTGCACAGCCAGG + Intronic
1033210053 7:139453804-139453826 GACTCACTCAGTGCCCAGGCCGG - Intronic
1036052940 8:5220479-5220501 GACTCACTCATGGCACAAAAAGG - Intergenic
1037856655 8:22376199-22376221 GTCTCACTCAGTGCACAGGCTGG + Intronic
1038298583 8:26320609-26320631 TATGAACTAATTGCACAGACAGG - Intronic
1038866759 8:31446792-31446814 TAGTGATTCATTGCACAGAATGG + Intergenic
1040545283 8:48394157-48394179 TTATCACTCCATGCACAGACAGG - Intergenic
1044861628 8:96529655-96529677 TACTCACTCACTCTACAAACAGG - Intronic
1047863887 8:129000439-129000461 TACCCACCCATTGTAAAGACTGG - Intergenic
1051029510 9:12657925-12657947 TACTCACTCTTTGCAGATCCTGG + Intergenic
1053068992 9:35089801-35089823 TACTCTATCAGTGGACAGACTGG - Intronic
1055299161 9:74865041-74865063 TTCTCTCTCATTGCCCAGGCTGG - Intronic
1055477422 9:76676994-76677016 TACCCACTGTTTGCACAGATCGG - Intronic
1058100099 9:100909870-100909892 TACTCACTCATTGCATTTTCAGG + Intergenic
1059276817 9:113104908-113104930 TACTCACTCAGGGCAGAGACAGG + Intergenic
1059479035 9:114573723-114573745 GTCTCACTCATTGCCCAGGCTGG - Intergenic
1059723544 9:116984795-116984817 TACCCACTCATTTTACAGATGGG - Intronic
1060815956 9:126635256-126635278 CACTCGCTCATTGCCCACACAGG + Intronic
1061241822 9:129378866-129378888 TACACACCCATTGCCCAGATGGG + Intergenic
1061800772 9:133112469-133112491 TATTCAGCCATTGCACAGATGGG + Intronic
1187031300 X:15491215-15491237 TACTCTCTCAGTGCTCAGCCGGG - Exonic
1187354636 X:18555763-18555785 TACTCACTCATGTCAAACACAGG + Intronic
1189317639 X:40067210-40067232 TAATCACTTATTTCACAGACTGG + Intronic
1189826798 X:44926937-44926959 TATTCTCTCATTTTACAGACTGG - Intronic
1189987643 X:46568506-46568528 GTCTCACTCATTGCCCAGGCTGG + Intergenic
1192340627 X:70260325-70260347 AACCCACTCATTGTACAGATTGG + Intergenic
1192456629 X:71281795-71281817 GTCTCACTCATTGCCCAGGCTGG + Intergenic
1194187152 X:90786350-90786372 GTCTCACTCATTGCCCAGGCTGG - Intergenic
1196437085 X:115684214-115684236 TACTCACAGGTTGTACAGACAGG - Intergenic
1199766649 X:150946293-150946315 TTCTCATTCATTGCCCAGGCTGG - Intergenic
1200036198 X:153333112-153333134 TACACACACATTGCACATAATGG + Intergenic
1202060576 Y:20883553-20883575 TTCTCTCTTGTTGCACAGACTGG - Intergenic