ID: 907490457

View in Genome Browser
Species Human (GRCh38)
Location 1:54805954-54805976
Sequence AAGGACCCTGAAAATGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907490452_907490457 1 Left 907490452 1:54805930-54805952 CCATTACATCTGCAGGGGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 173
Right 907490457 1:54805954-54805976 AAGGACCCTGAAAATGTGCACGG 0: 1
1: 0
2: 2
3: 24
4: 246
907490448_907490457 22 Left 907490448 1:54805909-54805931 CCATATTAAATACAAGAAGGGCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 907490457 1:54805954-54805976 AAGGACCCTGAAAATGTGCACGG 0: 1
1: 0
2: 2
3: 24
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907490457 Original CRISPR AAGGACCCTGAAAATGTGCA CGG Intergenic
901526534 1:9826346-9826368 AAGGTCCCTGGAAATCTACAGGG - Intergenic
903379504 1:22886951-22886973 GAGGACCCAGGAAATGTGAAGGG + Intronic
904572146 1:31474261-31474283 AAGATACCTGAAAATGTGGAAGG - Intergenic
904897647 1:33828964-33828986 AAGGAACCTGAAAAGCTGCAGGG + Intronic
907490457 1:54805954-54805976 AAGGACCCTGAAAATGTGCACGG + Intergenic
908903381 1:68981508-68981530 AAAGACCCTTAGAATGTGCTAGG - Intergenic
909490051 1:76216097-76216119 AAAGACCCTGAGATGGTGCATGG - Intronic
911212176 1:95153832-95153854 AATGTCCCTGGAAATGTGAAAGG + Intronic
913203663 1:116516515-116516537 AAAGACACTGAATATTTGCAAGG - Intronic
913616851 1:120569051-120569073 AAAGACCCTTACAATGTGGAAGG - Intergenic
913617135 1:120572216-120572238 CAGGTCCTTGAAAATGTGCTGGG - Intergenic
914260612 1:145996202-145996224 AACGACCCTGAAAAGGTGTACGG - Exonic
914573141 1:148938698-148938720 CAGGTCCTTGAAAATGTGCTGGG + Intronic
914573424 1:148941859-148941881 AAAGACCCTTACAATGTGGAAGG + Intronic
914742802 1:150479314-150479336 CATGACCCTGAACATGTCCAGGG - Intergenic
915225527 1:154408411-154408433 AAGGAGCCTGAAAATGGTCATGG + Intronic
915893187 1:159790332-159790354 AACGACCCTTGGAATGTGCAGGG + Intergenic
918278833 1:182982449-182982471 AAGGAAACTGAAAATGAGCAGGG - Intergenic
920285562 1:204876317-204876339 AAGTATCCTTAAAATATGCAGGG - Intronic
920677746 1:208049814-208049836 AAGTACCCTGGAAATGTGTCAGG + Intronic
921664711 1:217854731-217854753 GAGGACCCTGATGATGTCCAGGG + Intronic
922513323 1:226187088-226187110 CAGGCCCCTGCAAATGTGAAGGG - Intergenic
922626978 1:227057863-227057885 AAGGCCCCAGAAAGTCTGCAAGG + Intronic
923621460 1:235582817-235582839 AAGGAGGCAGAAAATATGCACGG - Intronic
1063289171 10:4724051-4724073 AAGGACCTTAAAAATGTCCATGG - Intergenic
1063497873 10:6526938-6526960 AAGGACCCTGGCAGCGTGCAGGG + Intronic
1065587640 10:27235127-27235149 AAGGACCCTGTAAACTTTCAAGG - Exonic
1070379111 10:75863802-75863824 AAGGACACTTAGAATGTGCTTGG + Intronic
1071110619 10:82150826-82150848 AAGGACACAGAAAATGTCCTAGG - Intronic
1072422879 10:95304198-95304220 AAGGACACTGAGAAGGAGCAGGG + Intergenic
1072536417 10:96367568-96367590 AAGAAACCTGAAAATATGGATGG - Exonic
1072615487 10:97046640-97046662 GAGGACCCTGTGAGTGTGCAGGG - Exonic
1074201039 10:111235410-111235432 AATTACTCTGAAAATTTGCAGGG + Intergenic
1074657863 10:115615934-115615956 AAGATACCTGAAAATGTGGAAGG + Intronic
1075520942 10:123143160-123143182 TAGGACTCTGGAAGTGTGCACGG + Intergenic
1075534671 10:123260303-123260325 AATGACACTGAAAATGTGTTGGG + Intergenic
1076462017 10:130654300-130654322 AAGGAGGCTGGAAATGTGCGTGG + Intergenic
1076597026 10:131630112-131630134 CAGGTCCCTGAAAATGGGCAGGG + Intergenic
1076647390 10:131962619-131962641 ACGGTCCCTGCAAATCTGCAAGG - Intergenic
1077193551 11:1266910-1266932 AAGATACCTGAAAATGTGGAAGG - Intergenic
1077425173 11:2472722-2472744 AAGGAGCCTGACAATGGGCAGGG - Intronic
1080851095 11:36070867-36070889 AAGGACCTTGACAAAGGGCAAGG - Intronic
1080921478 11:36713671-36713693 AAAGAAACTGAAAATGTGGAAGG - Intergenic
1084938063 11:72597699-72597721 TTGGACCCTGCACATGTGCAAGG + Intronic
1085920320 11:80947149-80947171 GAGGAAACTGAAAATGTGAAAGG - Intergenic
1086609754 11:88741568-88741590 ATGTGCCATGAAAATGTGCAGGG + Intronic
1088133631 11:106526809-106526831 AAAGAACCTGGAAAGGTGCAAGG - Intergenic
1088143796 11:106650100-106650122 AAGATACCTGAAAATGTGAAAGG - Intergenic
1088559457 11:111097852-111097874 TAGGACCCTGACAATTTCCATGG - Intergenic
1088843654 11:113647261-113647283 AGGGACCGTGAGAAGGTGCAGGG - Intergenic
1089388645 11:118085044-118085066 AAAGGTGCTGAAAATGTGCACGG + Intronic
1089887838 11:121845752-121845774 AAGGACACTGAAACTGAGAATGG + Intergenic
1090157674 11:124458721-124458743 GAGGACCCAGAAAATGTGGGGGG - Intergenic
1091678366 12:2508096-2508118 AAGGGCCATGAAGATCTGCAGGG - Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1093858885 12:24138923-24138945 GAGCACCCTGATAATATGCAAGG + Intergenic
1095201160 12:39386141-39386163 AAGGAAGCTTAGAATGTGCAGGG - Intronic
1095226828 12:39687208-39687230 AAGATACCTGAAAATGTGGAAGG - Intronic
1095312093 12:40711429-40711451 GAGGTCCCTAAAAATGTGAAGGG - Intronic
1096935331 12:55268094-55268116 AAGATACCTGAAAATGTGGAAGG + Intergenic
1097673888 12:62575316-62575338 TATGAAACTGAAAATGTGCATGG - Intronic
1098096530 12:66962629-66962651 AATGAGCCAGTAAATGTGCAGGG + Intergenic
1098393098 12:69990302-69990324 CAGGACCTGGAAAATGAGCAAGG - Intergenic
1099735117 12:86557455-86557477 GAGGGCCCAGATAATGTGCATGG - Intronic
1101262998 12:103052146-103052168 AAAGACACAGAAAATGTTCAAGG - Intergenic
1101672732 12:106891634-106891656 AAGGAGTCTGCAAATGTGTATGG + Intergenic
1102416093 12:112764066-112764088 AAGGAACCTGGAAATGTCCCAGG - Intronic
1102586187 12:113924576-113924598 GAGAACCTTCAAAATGTGCAAGG + Intronic
1103037982 12:117671863-117671885 CAGGATTCTGAAAATCTGCAAGG - Intronic
1104674461 12:130703288-130703310 CAGGAAACTGAAAATGTCCAGGG - Intronic
1105926661 13:25014839-25014861 AAGGGCCCTGAATATGTGCAGGG + Intergenic
1106797211 13:33218994-33219016 AAGGGCCCTGGAAATCTACAGGG + Intronic
1107465385 13:40645261-40645283 TAGGACCTTTAAAATGAGCAGGG - Intronic
1107852762 13:44587537-44587559 AAGGACCCTAAACATCTGAATGG - Intergenic
1108081503 13:46741884-46741906 AAGGACCCTGCAAAGGTTGAGGG - Exonic
1108271372 13:48763046-48763068 GATGACACTGAATATGTGCATGG - Intergenic
1109103817 13:58222935-58222957 TAAGAGCCTGAAACTGTGCAAGG + Intergenic
1111641445 13:90975748-90975770 AAGGACATTGAAAATGTTTACGG + Intergenic
1115046080 14:28995801-28995823 ACGGACATTGAAAATTTGCAAGG - Intergenic
1120248023 14:82028545-82028567 AAGATACCTGAAAATGTGGAAGG - Intergenic
1120642206 14:87028997-87029019 AATGACCCTGAAAATGTTATGGG + Intergenic
1121613669 14:95298427-95298449 AAGGAACCAGAAACTGTTCAAGG + Intronic
1122698381 14:103569769-103569791 AAGGACTCAGAAAATGTTCATGG - Intronic
1122714077 14:103683203-103683225 ACAGACCCTGGTAATGTGCAGGG + Intronic
1124099694 15:26682018-26682040 AAAGACCCAGAAAATATTCAGGG - Intronic
1124631314 15:31339103-31339125 GAGGACCCTGACCATGAGCAGGG - Intronic
1124860991 15:33441088-33441110 AGTGACCCTGAAAATGTGGCTGG - Intronic
1126308803 15:47292286-47292308 AAGAAACCTGTAAATGTGAATGG + Intronic
1127386555 15:58471959-58471981 AAGTACCCAGTAAATGTGTAAGG - Intronic
1127896296 15:63302272-63302294 GAGGACCCTGGCACTGTGCACGG - Intronic
1132655316 16:1039537-1039559 AGGGACCCTGAAACTGCCCAGGG + Intergenic
1133581135 16:7145634-7145656 AAACACCCAGAAAATGAGCATGG - Intronic
1137878753 16:52024222-52024244 TAGGACTCTGAAAATCAGCATGG - Intronic
1138407515 16:56809310-56809332 AAAGACCCTGAAGGTCTGCAGGG - Intronic
1144134566 17:12281134-12281156 AAGGACAGTGTAAGTGTGCAAGG + Intergenic
1147175099 17:38650675-38650697 GAGAATCCTGAAAATTTGCAGGG - Intergenic
1147190411 17:38735158-38735180 AAGGGCCCAGAAAAAGTGGAAGG + Exonic
1148351094 17:46942799-46942821 AAGGACACAGAAAATGGGGAAGG - Intronic
1150346009 17:64405293-64405315 AAGGACCATGCAACTGTTCATGG + Intronic
1151010871 17:70494543-70494565 AAGAAACCTGAAAATGGGCCAGG + Intergenic
1151159177 17:72150623-72150645 AAGGACTTTGAAAATGTGTTCGG - Intergenic
1152528913 17:80905661-80905683 AAGGACCCTGGCAATGTGCAGGG - Intronic
1153690953 18:7593008-7593030 AAGGACTCAGAAAATCTGAAAGG - Intronic
1158223968 18:55181321-55181343 AAGGAGATTGAAAATGTTCAGGG + Intergenic
1158567880 18:58570395-58570417 CAGCAGCCTGAAAATCTGCATGG - Intronic
1159212415 18:65342792-65342814 TAGAACCATGAAACTGTGCATGG + Intergenic
1159481362 18:68994866-68994888 AAGATACCTGAAAATGTGGAAGG + Intronic
925204545 2:1995257-1995279 AAGAACCCGGAAAATGCACAGGG + Intronic
925446042 2:3927916-3927938 CAGGACCCCGAAAAGGTGAATGG + Intergenic
925519762 2:4730431-4730453 AAAGCCCATGAAAATGTGCATGG - Intergenic
926006626 2:9377984-9378006 CTGCCCCCTGAAAATGTGCATGG - Intronic
926511979 2:13792427-13792449 AAGGACCCTCAAACTCTGAAAGG - Intergenic
928856171 2:35804971-35804993 ATGGACACTGAAAATGAGCAGGG + Intergenic
929907834 2:46061743-46061765 AAGTACCCTGGAGATGAGCACGG + Intronic
930415965 2:51092070-51092092 AAGGAACCTGACGATGTTCATGG - Intergenic
931262324 2:60631099-60631121 AAGGACTCTGAAAAAGTGTTGGG - Intergenic
931264287 2:60646704-60646726 AGGGCCCCTGAAGATGTGCAGGG - Intergenic
931941379 2:67255282-67255304 TAGGACACTGCCAATGTGCATGG - Intergenic
932003014 2:67901878-67901900 AAGTCACCTGAAAATTTGCAAGG + Intergenic
936526287 2:113243831-113243853 AAGGAACATGAAGATATGCAAGG - Intronic
944287865 2:197972632-197972654 ATGGACCCAGAAAATGTAAACGG - Intronic
945445389 2:209932019-209932041 AAGGACCCAGATAAAATGCAAGG - Intronic
948803427 2:240442993-240443015 AAGGACCCAGTAGCTGTGCAGGG - Intronic
949039115 2:241837911-241837933 AAGGACCCTTCCAAAGTGCAGGG + Intergenic
1169615506 20:7439184-7439206 ATGGACCATGAAAATTTGGAAGG - Intergenic
1169692361 20:8345747-8345769 AGGGATCCTGAAGATGTGCTGGG + Intronic
1170115350 20:12852243-12852265 AAGCAACCTGAAAATGTCAATGG + Intergenic
1170535201 20:17334347-17334369 GAGGACACTGGAAATGAGCATGG + Intronic
1172101417 20:32485803-32485825 AAGGTCTCTGAAAATGTGGTGGG - Intronic
1174504596 20:51009110-51009132 CAGGACCCAGAAAATGTGTCTGG + Intronic
1174649667 20:52113835-52113857 AAGTAACCAGAAAATGTACAAGG + Intronic
1174748210 20:53085658-53085680 AAGGCCCCTGAAAGAGGGCAAGG + Intronic
1175492363 20:59387843-59387865 AAGCACTCTAAAAATGTGCAGGG - Intergenic
1179961676 21:44770926-44770948 AAGGACCCAGAAAGGGTGCCGGG + Exonic
1181184995 22:21096803-21096825 GTGGACCCTTAAAAAGTGCAAGG + Intergenic
1181687112 22:24537007-24537029 AAGGAGTCTGAGAAGGTGCAGGG + Intergenic
1181810298 22:25400085-25400107 AAGGGCCTTGGAAATGGGCAGGG + Intronic
1183145930 22:35991656-35991678 AAGAACCCTGAGATTCTGCAAGG + Intronic
949239522 3:1853376-1853398 AAGGAACTTAAAAATGTGTAAGG - Intergenic
951930802 3:27965005-27965027 TAGGAGCCTCAAAATATGCAAGG + Intergenic
954592930 3:51799441-51799463 AAAGACTCTGAACATATGCAAGG - Intergenic
955476744 3:59344430-59344452 AATGACCTTGAAAATTTGCATGG + Intergenic
960973389 3:123154835-123154857 AAGGACCCTGACAGTGTGGCGGG + Intronic
961371133 3:126432550-126432572 AGGGACCTTGAAAATATGCTGGG + Intronic
962659492 3:137586644-137586666 AAGATACCTGAAAATGTGGAAGG - Intergenic
962979515 3:140474920-140474942 GAGGCCCCTGAGAAAGTGCAGGG - Intronic
963027333 3:140933034-140933056 AAGGATCTTGAAAAGGTTCACGG + Intergenic
963503055 3:146152669-146152691 ATGAACCCTCAAAATGTGCTGGG + Intronic
963584046 3:147161810-147161832 AAGGAAACTGAAACTGTGTAAGG - Intergenic
963792469 3:149598068-149598090 AAGGTCCCTGAATATGTGACAGG + Intronic
963849918 3:150200979-150201001 AAAGAACCTGAAAAGGTGAAGGG + Intergenic
964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG + Intergenic
964512083 3:157463783-157463805 AGGTATCCTGAAAATGTGAAAGG - Intronic
964663164 3:159143313-159143335 AAGAACCCTGAGAATTTGTATGG - Intronic
965097409 3:164250092-164250114 AATGACCCTTTAAATGTGAAAGG + Intergenic
965136021 3:164769536-164769558 AAGGACTATAAAAATGTACATGG + Intergenic
966035166 3:175403255-175403277 AAAGACTCTGAAATTGTGAAAGG - Intronic
966972698 3:185060176-185060198 AAGATACCTGAAAATGTGGAAGG + Intergenic
968352785 3:198075065-198075087 AAGGAACATGAAATTGTGAAAGG + Intergenic
969917390 4:10504074-10504096 AAAGACCCTGCAAATGAGCCGGG - Intronic
970541184 4:17081507-17081529 AAAGACCCTGCATATGAGCAAGG - Intergenic
971049922 4:22850055-22850077 AAGGAGTCTGAAAATCTACAGGG - Intergenic
971850900 4:31985485-31985507 AAGGGCCATGAAATTCTGCAAGG + Intergenic
971896725 4:32605893-32605915 AAGATACCTGAAAATGTGGAAGG - Intergenic
972095162 4:35339967-35339989 TAGGACCCTGAAACTTGGCAAGG + Intergenic
973297706 4:48543891-48543913 TAGGGCCCTGAAAATCTGAAAGG + Exonic
973638168 4:52878933-52878955 AGGGACCCTGAAAAGGGGAAAGG - Intronic
973824100 4:54687810-54687832 AAGGACCATGAAAGGGTGTAGGG - Intronic
974853508 4:67431577-67431599 AAGAAAACTGAGAATGTGCAAGG - Intergenic
976361915 4:84189662-84189684 AAAGAGCCTGAAAATATTCAAGG + Intergenic
976997137 4:91448589-91448611 AAGGACCCTGAATTTTTGCATGG - Intronic
979180996 4:117727037-117727059 AATTATCCTAAAAATGTGCATGG - Intergenic
979212591 4:118123322-118123344 AATCTCCCTGAAAATATGCAAGG - Intronic
980376702 4:131958358-131958380 AAGATACCTGAAAATGTGGAAGG - Intergenic
980462568 4:133135550-133135572 AAGGACCTTGAAAAAGAACACGG + Intergenic
981317550 4:143355338-143355360 AAAGGCTCTGGAAATGTGCAAGG - Intronic
982309889 4:153973902-153973924 AAGAAATCTGAAAATGTGGAAGG + Intergenic
983668979 4:170214334-170214356 AAGATACCTGAAAATGTGGAAGG + Intergenic
984392009 4:179148168-179148190 AAGCTCCCTGAAAATGGCCAAGG + Intergenic
986908135 5:12520070-12520092 AAGATACCTGAAAATGTGGAAGG - Intergenic
989328332 5:40225810-40225832 TAGGACCATGAAAAGATGCACGG + Intergenic
989403449 5:41034047-41034069 AAAGACTCTGCAAATGTACAAGG - Intronic
990264470 5:54060706-54060728 AAGATACCTGAAAATGTGGAAGG + Intronic
991293650 5:65058787-65058809 AAGATACCTGAAAATGTGGAAGG + Intergenic
994240885 5:97419399-97419421 ACAGACCCTGAAAATGTGCTTGG - Intergenic
995455061 5:112342491-112342513 AAGGGCCTTGAAAATGTGCCTGG - Intronic
995978904 5:118077856-118077878 AGTGACTATGAAAATGTGCAGGG - Intergenic
998086497 5:139329384-139329406 AAGGAAACTTAAGATGTGCAAGG + Exonic
1000129178 5:158278655-158278677 AAGGAGCCTGAAGATGTGTGTGG + Intergenic
1001957284 5:175856739-175856761 AAGGACGTGGCAAATGTGCAGGG + Intronic
1002017461 5:176336295-176336317 AAGGAACTTTAAAAAGTGCAGGG - Intronic
1005113855 6:22314938-22314960 AAGAAACCTGAAAATGTGGGAGG - Intergenic
1007865820 6:44969002-44969024 AATGACCCTGAAGATGGGGAGGG - Intronic
1008221712 6:48862490-48862512 AAGGAAACAGAAAACGTGCAGGG - Intergenic
1009193397 6:60656087-60656109 GAGAACCCTGAGTATGTGCACGG + Intergenic
1009345655 6:62610716-62610738 AAGATGCCTGAAAATGTGGAAGG - Intergenic
1009471825 6:64035614-64035636 TACATCCCTGAAAATGTGCAGGG + Intronic
1011871957 6:91906451-91906473 GAGGAACCTGAAAATGTGACTGG - Intergenic
1012115544 6:95293151-95293173 AAGGATCCTGGAAATATGCTTGG - Intergenic
1012519113 6:100098985-100099007 AAGGACCCTGAAAGAGTTCATGG - Intergenic
1012593283 6:101009714-101009736 AAGGAGCATGAAAATGATCAAGG + Intergenic
1013656292 6:112250317-112250339 CAGGACCCTAACAATGTGCTGGG + Intronic
1013732572 6:113185669-113185691 GAGGAGCCTCAAGATGTGCAAGG - Intergenic
1015202799 6:130601846-130601868 ATGGAACCTAGAAATGTGCATGG + Intergenic
1016895968 6:149053432-149053454 TATGACCCTGAACATGAGCATGG - Intronic
1017155651 6:151320522-151320544 AAGGACCCTGGGAATGGACAGGG - Intronic
1017642908 6:156511630-156511652 AAGGACCCTGCAGATGAGGAGGG + Intergenic
1018719508 6:166562084-166562106 AAGGACTCTGAAAATATCCAGGG - Intronic
1019095206 6:169574210-169574232 GAGGACCCTCAAAATGAGTAAGG - Intronic
1020565384 7:9788208-9788230 AAGATACCTGAAAATGTGGAAGG - Intergenic
1020747797 7:12099671-12099693 AAGGTACCTGAAAATGTGGAAGG + Intergenic
1021001921 7:15341608-15341630 AAAGTACCTGAAAATGTGGAAGG - Intronic
1021471166 7:21003517-21003539 AAGCTCCCAGAAGATGTGCATGG - Intergenic
1022089742 7:27099820-27099842 AACCACACTGAAAATGTGGAGGG + Intergenic
1022571538 7:31458708-31458730 AACTACCCTGAAGATGGGCAGGG - Intergenic
1024382039 7:48708169-48708191 AAGTATCCTGAACTTGTGCAAGG - Intergenic
1026563207 7:71467781-71467803 AAAAACCCTCAAAATCTGCAGGG + Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029614182 7:101645928-101645950 AAGCACCTTGAATATGTCCAGGG + Intergenic
1030007356 7:105132460-105132482 GTGGTCCCTGAAAATGTGCAGGG - Intronic
1030528892 7:110687535-110687557 AGGGAACTTCAAAATGTGCATGG + Intronic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1030747238 7:113181739-113181761 AATGACCTTGAAAATGACCAAGG + Intergenic
1031137491 7:117900924-117900946 AAGGACCCTGAAATTATACTGGG + Intergenic
1031650745 7:124286581-124286603 AGGGATCCTGAAAATCAGCATGG + Intergenic
1032016327 7:128382581-128382603 AAGGCAGCTGAATATGTGCAGGG - Intergenic
1032322442 7:130897546-130897568 GAGGACCCTGAAAACCTGCAGGG + Intergenic
1032342956 7:131093128-131093150 AAGGACCCTGAAATTCTATATGG + Intergenic
1032790895 7:135241679-135241701 AAGGGCTGTGAAAATGTACAAGG - Intronic
1033387406 7:140891832-140891854 AACAACCCTGAAAAAATGCAAGG + Intronic
1033641343 7:143265151-143265173 CATGACCCTGAAAACGTGCCTGG - Exonic
1034730982 7:153387474-153387496 AAGGAACCTGAAAACAAGCAAGG - Intergenic
1035557652 8:578764-578786 AAGGACCCTGAGGAAGTGCAGGG - Intergenic
1037010936 8:13841637-13841659 AAGGAAGCTGGAAGTGTGCATGG + Intergenic
1042684169 8:71418967-71418989 AAAGCACCTGAAAATCTGCAAGG + Intronic
1046273902 8:111931701-111931723 AAGGTCCCTAAAGATGTGCTGGG + Intergenic
1046521993 8:115336912-115336934 AATGACACTGAAAATTTGCGAGG + Intergenic
1047018283 8:120746835-120746857 AATCATCTTGAAAATGTGCATGG + Intronic
1047608746 8:126500084-126500106 ATGGTCCCTGAAGCTGTGCAGGG - Intergenic
1050307988 9:4325346-4325368 TAGAACCCTGAAAATGTGCTAGG + Intronic
1051576551 9:18622477-18622499 AATGAACCTGAAAATGTAGAAGG + Intronic
1052337044 9:27330677-27330699 AAGGATCCTGAAAATGCTCTTGG + Intronic
1052873393 9:33530879-33530901 AAGGAACATGAAATTGTGAAAGG - Intronic
1053502708 9:38613867-38613889 AAGGAACATGAAATTGTGAAAGG + Intergenic
1053804100 9:41784053-41784075 AAGGACCCTGAAGATCACCAGGG - Intergenic
1054141182 9:61531406-61531428 AAGGACCCTGAAGATCACCAGGG + Intergenic
1054192406 9:61995549-61995571 AAGGACCCTGAAGATCACCAGGG - Intergenic
1054460872 9:65461842-65461864 AAGGACCCTGAAGATCACCAGGG + Intergenic
1054646000 9:67593142-67593164 AAGGACCCTGAAGATCACCAGGG + Intergenic
1055779571 9:79805066-79805088 AAGAACCCAGAAAATCTTCATGG - Intergenic
1057138220 9:92710123-92710145 AAGGACCCAGAAGATGAGGATGG + Intergenic
1057153385 9:92815761-92815783 AAGGAACATGAAATTGTGAAAGG - Intergenic
1057682534 9:97203145-97203167 AAGGAACATGAAATTGTGAAAGG + Intergenic
1059812106 9:117866862-117866884 AAGAAACTTGACAATGTGCAGGG + Intergenic
1060157907 9:121332757-121332779 AAGGACTCTGAATTTTTGCAGGG - Exonic
1186797759 X:13063132-13063154 AAGATACCTGAAAATGTGGAAGG - Intergenic
1188937484 X:36194425-36194447 AAGATACCTGAAAATGTGGAAGG - Intergenic
1188939081 X:36215407-36215429 AAGGAGCCTGAAACTGAGCATGG + Intergenic
1192276560 X:69637360-69637382 AAGGACTCTGAAATTGTTCCTGG + Intronic
1192895446 X:75438480-75438502 ATGGACACTAAAAATATGCAGGG - Intronic
1193070838 X:77303861-77303883 TAGGTCCCTGAAGGTGTGCATGG - Intergenic
1193886249 X:86986233-86986255 TAGGAGCCTGAAAAAGTGCTTGG - Intergenic
1194083786 X:89500771-89500793 AAGATACCTGAAAATGTGGAAGG - Intergenic
1196726166 X:118897569-118897591 AATGAGCCAGAAAATGTTCAAGG + Intergenic
1198840982 X:140857927-140857949 TAGGACCAGGAGAATGTGCAGGG - Intergenic
1199206639 X:145156764-145156786 AAGGATGCTGATCATGTGCAAGG + Intergenic
1199708240 X:150449706-150449728 AGGGACCCTGGAAATGTGGCAGG - Intronic
1199731906 X:150642048-150642070 ACAGACCCTGAAAATTAGCAGGG - Intronic
1200436435 Y:3156653-3156675 AAGATACCTGAAAATGTGGAAGG - Intergenic
1201265837 Y:12205751-12205773 GAGGACCCTGAAGAGGTGCTTGG + Intergenic
1201800850 Y:17953615-17953637 AAGGAGACTGAAAATATCCAAGG + Intergenic
1202360632 Y:24106129-24106151 AAGGAGACTGAAAATATCCAAGG + Intergenic
1202510146 Y:25563989-25564011 AAGGAGACTGAAAATATCCAAGG - Intergenic