ID: 907490469

View in Genome Browser
Species Human (GRCh38)
Location 1:54806010-54806032
Sequence CGCCCACGTGGCGCCCCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907490469_907490476 1 Left 907490469 1:54806010-54806032 CCGGTGGGGGCGCCACGTGGGCG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 907490476 1:54806034-54806056 GGGCGAGGCCCACAGCTCCGGGG 0: 1
1: 0
2: 2
3: 12
4: 196
907490469_907490481 18 Left 907490469 1:54806010-54806032 CCGGTGGGGGCGCCACGTGGGCG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 907490481 1:54806051-54806073 CCGGGGCGCATCACAAGGCCCGG 0: 1
1: 0
2: 0
3: 36
4: 846
907490469_907490475 0 Left 907490469 1:54806010-54806032 CCGGTGGGGGCGCCACGTGGGCG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 907490475 1:54806033-54806055 AGGGCGAGGCCCACAGCTCCGGG 0: 1
1: 0
2: 1
3: 30
4: 245
907490469_907490482 19 Left 907490469 1:54806010-54806032 CCGGTGGGGGCGCCACGTGGGCG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 907490482 1:54806052-54806074 CGGGGCGCATCACAAGGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 84
907490469_907490474 -1 Left 907490469 1:54806010-54806032 CCGGTGGGGGCGCCACGTGGGCG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 907490474 1:54806032-54806054 GAGGGCGAGGCCCACAGCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 241
907490469_907490483 28 Left 907490469 1:54806010-54806032 CCGGTGGGGGCGCCACGTGGGCG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 907490483 1:54806061-54806083 TCACAAGGCCCGGGTTGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 59
907490469_907490479 13 Left 907490469 1:54806010-54806032 CCGGTGGGGGCGCCACGTGGGCG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 907490479 1:54806046-54806068 CAGCTCCGGGGCGCATCACAAGG 0: 1
1: 0
2: 0
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907490469 Original CRISPR CGCCCACGTGGCGCCCCCAC CGG (reversed) Intergenic
900480382 1:2895337-2895359 AGCCCACATGGGTCCCCCACAGG + Intergenic
902078120 1:13803409-13803431 TACCCACCTGGCTCCCCCACTGG - Intronic
903263378 1:22142976-22142998 CGCCCACCTGCAGCCCCGACGGG - Intronic
905143686 1:35869776-35869798 CTCTCACGTGGCGTCCTCACAGG - Intergenic
907490469 1:54806010-54806032 CGCCCACGTGGCGCCCCCACCGG - Intergenic
911527635 1:99005052-99005074 CGCCCACGCAGCGCCTCCTCCGG - Intergenic
1069548349 10:69344804-69344826 CTCCAGCGTGGCGCCCTCACAGG + Intronic
1076692744 10:132232105-132232127 CGCTCACGCTGCGCCCTCACCGG + Intronic
1080577080 11:33609691-33609713 CTCCCACCTGCCGGCCCCACTGG + Intronic
1080966200 11:37217598-37217620 GCCCCACATGGAGCCCCCACTGG - Intergenic
1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG + Intergenic
1084542881 11:69798291-69798313 CACCCACCTGGAGACCCCACAGG - Intergenic
1091599145 12:1907633-1907655 CGCCCACCAGGCACCCTCACCGG - Intronic
1092247911 12:6873525-6873547 CGCCCCCGTGGAGCCCACCCCGG + Intronic
1114672956 14:24422375-24422397 GGCCCACCTGGAGCCCCCAGAGG + Intergenic
1121648150 14:95535128-95535150 CGCCCGCGCCGCGCCCCCAGCGG - Exonic
1122441841 14:101737336-101737358 AGCCCACCTGGAGCCCACACCGG + Intergenic
1127262334 15:57335428-57335450 CTCCCACCTGCCACCCCCACAGG - Intergenic
1130352935 15:83107546-83107568 CCCCCGCGTGGCGCCCTCAGCGG - Exonic
1131405859 15:92163847-92163869 CCCCCACCTGGCTCCCCCTCAGG - Exonic
1136778704 16:32884674-32884696 GGCCCGCCTGGCGCCGCCACTGG - Intergenic
1136891914 16:33976840-33976862 GGCCCGCCTGGCGCCGCCACTGG + Intergenic
1142113724 16:88345617-88345639 GGACCCCGTGGCGACCCCACGGG - Intergenic
1142194478 16:88733136-88733158 AGCCCCCTTGGCGCCCCCAGGGG + Intronic
1142293194 16:89201912-89201934 CCCCCACGTGCCGCCCTCACGGG - Intergenic
1203081121 16_KI270728v1_random:1146768-1146790 GGCCCGCCTGGCGCCGCCACTGG - Intergenic
1148725846 17:49789259-49789281 CGCCTAAGCCGCGCCCCCACAGG - Intronic
1149775434 17:59353354-59353376 AGCCCACGAGGCACTCCCACAGG - Exonic
1151975093 17:77480066-77480088 CCCCCACGTGGCCCCCACCCAGG - Intronic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1159996605 18:74970813-74970835 CCCCCACATGGAGTCCCCACTGG - Intronic
1160364049 18:78309221-78309243 CGCCCTCGGGACGCCTCCACGGG - Intergenic
1160985553 19:1837013-1837035 CGCCCAGATGGCTCCCCCAGGGG - Intronic
1163783251 19:19261469-19261491 CGGCCACGCTGCGCCCCCGCAGG + Exonic
1165709460 19:37999679-37999701 CGCACACGTGGGTCTCCCACTGG - Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
938149648 2:128871174-128871196 GGCCAATGTGGAGCCCCCACAGG + Intergenic
943355334 2:186848903-186848925 CGCCCACCAGGTTCCCCCACTGG - Intronic
948299378 2:236890565-236890587 CCCCCACGTGACTTCCCCACAGG + Intergenic
948479339 2:238240238-238240260 CGCCCCGGTGCCGCCCCCGCGGG - Intronic
948818067 2:240523648-240523670 CGTCACCGTGGCACCCCCACAGG + Intronic
948818081 2:240523695-240523717 CGTCACCGTGGCACCCCCACAGG + Intronic
948920789 2:241064977-241064999 CCCCCTCGTGGCTCCCTCACTGG - Intronic
1170890136 20:20369012-20369034 CGGCCCCGCGGCGCCTCCACCGG - Exonic
1176164019 20:63663534-63663556 CACCCACGTGGCTGCCCCTCGGG + Intronic
1176549997 21:8216968-8216990 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1176568923 21:8400002-8400024 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1176576837 21:8444237-8444259 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1180150503 21:45944729-45944751 CGCCCATGATGCGCGCCCACCGG - Intergenic
1180167526 21:46037736-46037758 CAGGCACGTGGCGCCCACACGGG + Intergenic
1181567865 22:23750863-23750885 CGGCGACGTGGCGCCCCTACAGG + Exonic
1184562067 22:45269158-45269180 CGCCCGCGTTGCGCCGCCAGGGG + Intergenic
1203254887 22_KI270733v1_random:133294-133316 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1203262943 22_KI270733v1_random:178373-178395 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
950559326 3:13712851-13712873 CCTCCACGTGGCCCCCCCAAAGG - Intergenic
951981774 3:28575176-28575198 CGCCCAGCTGGCGCCCGCCCCGG + Intergenic
952221361 3:31327197-31327219 CTCCCACATGGAGTCCCCACTGG - Intergenic
953886662 3:46717948-46717970 CGCCTGCGTGGCGCCCCCCAGGG + Exonic
954861431 3:53694218-53694240 AGCCCCAGTGGAGCCCCCACGGG - Intronic
964926431 3:161963789-161963811 CCCCCACATGGAGACCCCACTGG + Intergenic
968575996 4:1366445-1366467 CACCCAGGTGCCCCCCCCACGGG - Intronic
969213944 4:5708475-5708497 CACCCACGTGGGGCGCCCCCGGG + Exonic
969670920 4:8589861-8589883 AGCCCATGTGGCTCCCACACTGG + Intronic
971257975 4:25031036-25031058 CGGCCCCGTGGCGCCCCACCCGG + Intergenic
974843418 4:67323546-67323568 CCCCCACATGGAGACCCCACAGG + Intergenic
978255988 4:106693645-106693667 CCCCCACATGGAGTCCCCACTGG + Intergenic
979205606 4:118033779-118033801 CGCCCGCTTGTCGCCCCCGCCGG + Intronic
985653948 5:1120296-1120318 CGTCCACAGGGCCCCCCCACCGG + Intergenic
987252297 5:16112140-16112162 CCCCCACATGGAGTCCCCACTGG + Intronic
994137206 5:96301934-96301956 CGCCCACATAGAGTCCCCACTGG - Intergenic
999062763 5:148653989-148654011 CGCCCCCGCCGCGTCCCCACCGG + Intronic
1003241183 6:4347071-4347093 GGCCCACCAGGAGCCCCCACTGG - Intergenic
1004811804 6:19270822-19270844 CGCCCACCTGGAACCCCCACCGG - Intergenic
1006014905 6:31072688-31072710 CCCACTCGTGGCCCCCCCACTGG + Intergenic
1008673302 6:53794923-53794945 CGCCCTCGGCGCGCACCCACTGG + Intronic
1008675462 6:53813376-53813398 TGCCCACTTGGCGCTGCCACAGG - Intronic
1014551044 6:122789695-122789717 CGCCCTTGGAGCGCCCCCACCGG - Intronic
1016982491 6:149865200-149865222 CGCCAAGGTGAAGCCCCCACTGG - Intergenic
1018613403 6:165663289-165663311 CGCCCACGTAGCGCGCCCCGCGG + Intronic
1019331121 7:461402-461424 TGCCCACGTGGGGCTCCCTCTGG - Intergenic
1019738198 7:2660642-2660664 CCCCTCCGTGGCGTCCCCACAGG + Intronic
1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1024520893 7:50303868-50303890 CGCCCGCGCCGCGCCCCCACGGG + Intergenic
1027266522 7:76497891-76497913 AGCCCACGTGGCGGCCACACAGG - Intronic
1027317903 7:76996009-76996031 AGCCCACGTGGCGGCCACACAGG - Intergenic
1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029759618 7:102593742-102593764 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1032366789 7:131307344-131307366 CTCCCACATGGAGTCCCCACTGG + Intronic
1035580721 8:737906-737928 CGCCCTCGGGGCGTCCCCGCGGG - Intronic
1046735191 8:117768935-117768957 CCCCCACATGGTGTCCCCACTGG + Intergenic
1049308682 8:141921632-141921654 CACCCACGTGCAGCCCCCATAGG - Intergenic
1049725203 8:144142562-144142584 GGCCCAGGTGCCGCCCTCACTGG + Intergenic
1052896337 9:33750957-33750979 AGCCCACCTGGGGCCCCCTCCGG + Intronic
1053050499 9:34957875-34957897 CGCCCCCAAGGCGCCCCCTCCGG + Intronic
1060254554 9:122015656-122015678 TGGCCACCTGGCGCTCCCACCGG + Intronic
1203471288 Un_GL000220v1:116439-116461 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1203479109 Un_GL000220v1:160411-160433 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1190096245 X:47483088-47483110 AGCCCACCTGGCGGCCCCACTGG + Intergenic
1194841701 X:98752046-98752068 CCCCCACATGGAGTCCCCACTGG - Intergenic
1195536333 X:106012971-106012993 CCCTCACATGGAGCCCCCACTGG + Intergenic
1198388006 X:136147261-136147283 CGCCCACGTGCCCCCGCCACTGG - Intergenic
1200101112 X:153689367-153689389 GGCCCGCCTGGCGCCGCCACTGG + Intronic