ID: 907491301

View in Genome Browser
Species Human (GRCh38)
Location 1:54810570-54810592
Sequence CTGGGGAAGCAGGATGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907491301_907491318 4 Left 907491301 1:54810570-54810592 CCCGCCCCATCCTGCTTCCCCAG No data
Right 907491318 1:54810597-54810619 GGGTTCCAGGCTCAGAGGTAGGG 0: 1
1: 0
2: 0
3: 21
4: 230
907491301_907491321 24 Left 907491301 1:54810570-54810592 CCCGCCCCATCCTGCTTCCCCAG No data
Right 907491321 1:54810617-54810639 GGGCATGGCTGAGCCATCTATGG 0: 1
1: 0
2: 0
3: 16
4: 167
907491301_907491315 -1 Left 907491301 1:54810570-54810592 CCCGCCCCATCCTGCTTCCCCAG No data
Right 907491315 1:54810592-54810614 GGGCCGGGTTCCAGGCTCAGAGG 0: 1
1: 0
2: 7
3: 24
4: 280
907491301_907491320 9 Left 907491301 1:54810570-54810592 CCCGCCCCATCCTGCTTCCCCAG No data
Right 907491320 1:54810602-54810624 CCAGGCTCAGAGGTAGGGCATGG No data
907491301_907491311 -9 Left 907491301 1:54810570-54810592 CCCGCCCCATCCTGCTTCCCCAG No data
Right 907491311 1:54810584-54810606 CTTCCCCAGGGCCGGGTTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 277
907491301_907491317 3 Left 907491301 1:54810570-54810592 CCCGCCCCATCCTGCTTCCCCAG No data
Right 907491317 1:54810596-54810618 CGGGTTCCAGGCTCAGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907491301 Original CRISPR CTGGGGAAGCAGGATGGGGC GGG (reversed) Intronic
No off target data available for this crispr