ID: 907491349

View in Genome Browser
Species Human (GRCh38)
Location 1:54810806-54810828
Sequence GGCTGAATGCCTTGCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907491349 Original CRISPR GGCTGAATGCCTTGCGGGGC AGG (reversed) Intronic
900164913 1:1240705-1240727 GGCTGAATGAGTTGGGGGCCAGG - Intergenic
900399103 1:2465755-2465777 GGCTGAGTGGCGGGCGGGGCTGG + Intronic
900899893 1:5509255-5509277 GGCTGAATCCCTCGCAGGGCCGG - Intergenic
901700694 1:11043600-11043622 GGGTGGATGCCTTGGGGAGCAGG + Intronic
902701897 1:18178205-18178227 GGCTGTATGCATTTTGGGGCTGG - Intronic
906674147 1:47681144-47681166 GGCTGAATGCACTGTGAGGCAGG + Intergenic
907491349 1:54810806-54810828 GGCTGAATGCCTTGCGGGGCAGG - Intronic
914047230 1:144102754-144102776 GGCTGGATGCCTGGCTTGGCTGG + Intergenic
914048107 1:144106645-144106667 GGCTGGCTGCCTTGCTTGGCTGG + Intergenic
914131076 1:144858803-144858825 GGCTGGCTGCCTTGCTTGGCTGG - Intergenic
916849973 1:168693879-168693901 GGCTGAAGGCCTTGTGAGGCAGG + Intergenic
916979388 1:170116692-170116714 GACTGAAGGCCTTGCAGGGTCGG + Intergenic
920577494 1:207072311-207072333 GGCTGAGGGGCTTGAGGGGCCGG - Exonic
922357745 1:224792579-224792601 GCCTGAATGCTTTGCTGGGTTGG + Intergenic
923202501 1:231725792-231725814 GGCTGAAGGCCCTTCTGGGCTGG + Intronic
924708526 1:246516883-246516905 GGCTGACTGCCATCTGGGGCAGG - Intergenic
1064297201 10:14089345-14089367 GGCTTCATGCACTGCGGGGCTGG - Intronic
1067751222 10:48973000-48973022 TGCTGGATGCCTTGTGGTGCTGG + Intronic
1069900253 10:71702763-71702785 GGCTGAAAACTTTGCAGGGCTGG + Intronic
1076107487 10:127834981-127835003 GGCTGGATGCCTGGCAGAGCAGG + Intergenic
1076661659 10:132059591-132059613 GGCTGCATGCCCTGAGGGGTCGG - Intergenic
1077484190 11:2831380-2831402 GGGTGAATGCCTTGTAGGCCTGG + Intronic
1077806486 11:5596044-5596066 GGCTGGATCTCCTGCGGGGCTGG + Intronic
1078669057 11:13348796-13348818 GAATGAATGCCTTGGGAGGCTGG + Intronic
1080858224 11:36130519-36130541 GCCTGAATGACTCGCAGGGCTGG + Intronic
1081636575 11:44726355-44726377 GGCTGAGGTTCTTGCGGGGCTGG - Intergenic
1083628772 11:64085388-64085410 GGCTGCCTGCCTTCCGGGGACGG + Intronic
1084003978 11:66313678-66313700 TGCTCACTGCCTTGGGGGGCGGG - Intergenic
1089847804 11:121471981-121472003 GTCTGAATGCCTTTGGTGGCCGG + Intronic
1090260526 11:125315588-125315610 GGCAGACTGCCTTGCAGGGCTGG + Intronic
1091155617 11:133368825-133368847 GGCTGAATACCATGCTGGGTAGG - Intronic
1093525852 12:20102665-20102687 GGCTGCATGCCCTGTGGAGCTGG - Intergenic
1096523764 12:52198709-52198731 TGCTCAATGCCTTGCAGGGAGGG + Intergenic
1103736524 12:123064357-123064379 GGCTGCAGGCCTTGGGGTGCTGG - Intronic
1104643493 12:130481843-130481865 GGCTGACAGCCCAGCGGGGCGGG - Intronic
1107565753 13:41602369-41602391 GGCTGTATGGCTAGCGAGGCAGG - Intronic
1112509236 13:99994118-99994140 GGCTGAATGTCTGGCGCTGCGGG + Intergenic
1114065113 14:19053769-19053791 GGCTGGATGCCTTGCCAGGGCGG - Intergenic
1114097150 14:19346233-19346255 GGCTGGATGCCTTGCCAGGGCGG + Intergenic
1118025212 14:61761797-61761819 GGGTGAATGCGTGGCAGGGCAGG + Intergenic
1119774420 14:77239602-77239624 GGCGCCATGCCATGCGGGGCCGG + Exonic
1123698546 15:22897335-22897357 TGTTGAATGTCTTGGGGGGCAGG + Intronic
1124957083 15:34366862-34366884 GGCTGAGAGGCTTGCGGAGCGGG - Intronic
1126398080 15:48240456-48240478 GGCTTACTGCCATGTGGGGCAGG + Intronic
1128008032 15:64263663-64263685 GGCTGAGTGCCTGAAGGGGCAGG - Intronic
1133328679 16:4958046-4958068 GGCTGAGGGCCTTGGAGGGCGGG + Intronic
1135118967 16:19748921-19748943 GGCTGAAATACTTGCAGGGCTGG - Intronic
1136241250 16:28945658-28945680 GGCTGAAGGCCTCCTGGGGCTGG + Intergenic
1138350140 16:56342019-56342041 GGCTGAGTGCCTGGCAGGCCAGG + Intronic
1138510761 16:57507434-57507456 TGCTGAAGGCCTAGCAGGGCTGG - Intergenic
1142219029 16:88843965-88843987 GGCTGAGTGGCTGCCGGGGCTGG + Intronic
1142867132 17:2797849-2797871 GGCTGTGGGCCTTGCAGGGCAGG + Intronic
1143204738 17:5133812-5133834 GGCTGACTGCCATTTGGGGCAGG + Intronic
1143223551 17:5282022-5282044 GGCTGAGTGCCGAGCGGAGCTGG - Intergenic
1144875791 17:18396491-18396513 GGCTGACTGCCATTTGGGGCAGG + Intergenic
1144888304 17:18478554-18478576 GGCTGAGTGCCATGAGGGCCTGG + Intronic
1145143902 17:20465748-20465770 GGCTGAGTGCCATGAGGGCCTGG - Intronic
1145156437 17:20547930-20547952 GGCTGACTGCCATTTGGGGCAGG - Intergenic
1145791973 17:27632945-27632967 GGCTGAGTGCCATGAGGGCCTGG + Intronic
1146160462 17:30556798-30556820 GGCTGACTGCCATTTGGGGCAGG + Intergenic
1146466927 17:33093746-33093768 GGCAGAATGCATAACGGGGCAGG + Intronic
1146786544 17:35726528-35726550 GGCTGAATCCCTGGGAGGGCTGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150724717 17:67642351-67642373 GGCTGACTGTCTTGTGGGGATGG + Intronic
1153823831 18:8856473-8856495 TGCTGAATGCCTTGCTTGTCAGG - Intergenic
1157464360 18:47930982-47931004 GGCCGAAAGCCGCGCGGGGCGGG + Intronic
1161471225 19:4457574-4457596 GGCTTGAGGCCCTGCGGGGCGGG - Intronic
1162070141 19:8148305-8148327 GGCTGGATGCCTCCCTGGGCAGG + Intronic
1162627138 19:11893751-11893773 AGCTGAATGCCTTGTGGTGGAGG + Intronic
1163015158 19:14450439-14450461 CGCTGACTGCCTTGCGGTCCGGG - Exonic
1164529970 19:29041158-29041180 GGCTGACTGCCTAGAGGGGTGGG + Intergenic
1165072014 19:33261162-33261184 GGCTGAAGGCCTGGGGGGGATGG + Intergenic
1166067799 19:40370277-40370299 GGCTGGGTGCCCTGTGGGGCAGG - Intronic
1168687280 19:58356531-58356553 GGCTGAAGGCCTTGCCGCACTGG + Exonic
1168703644 19:58455808-58455830 GGCTGAAGGCCTTGCCGCACTGG - Exonic
1168706152 19:58471356-58471378 GGCTGAAGGCCTTGCCGCACTGG - Exonic
927192235 2:20524668-20524690 AACTGAATGCCTTGCGAGGCTGG + Intergenic
929918653 2:46156562-46156584 CGCTGAATGCCTTGCCTAGCAGG - Intronic
932380447 2:71276974-71276996 GGCAGAACGCCTGGCCGGGCCGG + Intronic
933963870 2:87420793-87420815 GGCTGAATGGCTTGCCCGGCTGG - Intergenic
945943268 2:215970646-215970668 GGCTGAATGACTTGCTAGTCAGG - Intronic
948019719 2:234720528-234720550 GGCTGAGTTCCCTGCGGGGAAGG - Intergenic
948342423 2:237265102-237265124 GGCTGGAGGCCTTGGGGAGCTGG - Intergenic
948479191 2:238239772-238239794 GGCGGGAGGCCGTGCGGGGCTGG - Intronic
1168949151 20:1784681-1784703 GGCAGCCTGCCTTGTGGGGCTGG + Intergenic
1171810575 20:29742471-29742493 GGCTGGATGGCTTGCTGGCCTGG - Intergenic
1172273536 20:33667710-33667732 GTGTGATGGCCTTGCGGGGCAGG - Exonic
1172776489 20:37410296-37410318 GGGCGAATGCCATGCCGGGCAGG + Intergenic
1176370705 21:6060078-6060100 GGGTGGATGGCTTGCTGGGCGGG - Intergenic
1179187771 21:39097781-39097803 GGCTGCATGCCTTTGAGGGCAGG + Intergenic
1179752814 21:43478463-43478485 GGGTGGATGGCTTGCTGGGCGGG + Intergenic
1180483603 22:15776389-15776411 GGCTGGATGCCTTGCCAGGGCGG - Intergenic
1180952935 22:19728893-19728915 GGCTGAGGGCCTTCCTGGGCCGG - Intergenic
1180955003 22:19737642-19737664 GGCTGAGGGCCCTGGGGGGCAGG - Intergenic
1181010410 22:20037018-20037040 GTCAGAATGCCTCTCGGGGCGGG + Exonic
1182034044 22:27183689-27183711 AGCTGAATGCCTGGCAGGGCTGG - Intergenic
1182453212 22:30433296-30433318 GGCTGAGAGCCTTCCAGGGCTGG + Intergenic
1182917665 22:34050050-34050072 GGCTGGATGCCTTGTGAGGTAGG + Intergenic
1184040729 22:41941692-41941714 GGAGGAAAGCCTGGCGGGGCAGG + Intronic
1184850406 22:47116508-47116530 GGCTGCCTGCCTTGGGAGGCTGG + Intronic
950696297 3:14703618-14703640 GGCAGAAAGCATTGCTGGGCAGG - Intronic
951700697 3:25493528-25493550 GGCTGAATGACTACCTGGGCTGG + Intronic
961087565 3:124082145-124082167 GGCTGCATGGCTTCCCGGGCTGG + Intronic
961450743 3:127001274-127001296 GGGTGGATGCCTTGCAGGCCGGG + Intronic
967111113 3:186294822-186294844 GGCTGAGTGGCGTGCTGGGCAGG + Intronic
968186059 3:196634270-196634292 GGCTGAAGGCAGTGCGGGGGTGG - Intergenic
970365678 4:15355705-15355727 GGGTTAATGCCTTGCATGGCAGG - Intronic
975485910 4:74933821-74933843 GGCTGCGCGCCTGGCGGGGCTGG + Intronic
985478841 5:94578-94600 GGATGAGTGGCTGGCGGGGCTGG + Intergenic
990438671 5:55821828-55821850 GGGAGAACGCCTCGCGGGGCGGG + Intergenic
991777463 5:70099115-70099137 GGCTGAAGGCATTGCAGAGCTGG - Intergenic
991856751 5:70974559-70974581 GGCTGAAGGCATTGCAGAGCTGG - Intronic
997569795 5:134917563-134917585 GACTGAATGCCCTGCTGGGCAGG - Intronic
998256232 5:140591015-140591037 GGCCAAATGCCTAGCGGGGATGG + Intronic
999223681 5:150001888-150001910 GGCTGAAAGCCTTGTGGAGAAGG - Intronic
1001237988 5:170045925-170045947 GGCTGAATGCCCTGCAGGCTGGG + Intronic
1003525757 6:6895515-6895537 GGCTCAGTGCCTTGGGAGGCTGG + Intergenic
1004005170 6:11631647-11631669 GGCTGAATGCCTCTCCGGCCTGG - Intergenic
1005358338 6:25006890-25006912 GGCTGAAAGCCTAGAGGAGCTGG + Intronic
1006678440 6:35779866-35779888 ATCTGAATGTTTTGCGGGGCGGG + Intergenic
1013507391 6:110814572-110814594 GGCTGAGCGCCTCGCGGGGGCGG - Intronic
1014668143 6:124265741-124265763 GGCTGATTGCCTTGCTGGCCTGG - Intronic
1019517259 7:1445549-1445571 TGGTGAATGCGTGGCGGGGCGGG - Intronic
1019538631 7:1541499-1541521 GGTGGAAAGCCTTGAGGGGCAGG + Exonic
1020093245 7:5353101-5353123 GGCTGGTAGCCTGGCGGGGCTGG - Intronic
1026685006 7:72502216-72502238 TGCTGAATTGCTTGTGGGGCGGG + Intergenic
1032330094 7:130970555-130970577 AGCTGAATGGCTTATGGGGCAGG + Intergenic
1033673521 7:143515286-143515308 GGCTGAGAGCCTTGCTGGGCTGG + Intergenic
1036999783 8:13704664-13704686 GGCTGAATGCTGTGCAGTGCTGG + Intergenic
1038450599 8:27636760-27636782 GGCTGCATGGGCTGCGGGGCTGG + Intronic
1040734678 8:50491112-50491134 GGCTGCATCCCCAGCGGGGCAGG - Intronic
1042370237 8:67983278-67983300 TCATGAATGCCTTGTGGGGCAGG - Intronic
1057126411 9:92619457-92619479 GGCTGCATGCCTTGCAGTGGGGG + Exonic
1057200184 9:93135535-93135557 GGCTCAATTCCTGGAGGGGCAGG + Intergenic
1203360841 Un_KI270442v1:218216-218238 GGCTGGATGCCTTGCTGGCCTGG - Intergenic
1190019158 X:46856700-46856722 TGCTGAATGCCTGGTGGAGCAGG + Intronic
1190878670 X:54477248-54477270 TGCTGAATGCCTGGGGGGGCAGG - Intronic
1194347589 X:92785269-92785291 GATTGAATGTCTTGGGGGGCAGG - Intergenic
1197296799 X:124729109-124729131 TGCTGAATGCCTCGCTGTGCAGG + Intronic
1197979160 X:132197666-132197688 GGCTGATTGCCTTGTGGGAGTGG + Intergenic
1200655912 Y:5901903-5901925 GATTGAATGTCTTGGGGGGCAGG - Intergenic