ID: 907494637

View in Genome Browser
Species Human (GRCh38)
Location 1:54835786-54835808
Sequence CAGCCTGAGAAGAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 408}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907494631_907494637 -4 Left 907494631 1:54835767-54835789 CCTCCCCAGAGTTACAGGGCAGC No data
Right 907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG 0: 1
1: 0
2: 2
3: 43
4: 408
907494634_907494637 -9 Left 907494634 1:54835772-54835794 CCAGAGTTACAGGGCAGCCTGAG 0: 1
1: 0
2: 0
3: 35
4: 437
Right 907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG 0: 1
1: 0
2: 2
3: 43
4: 408
907494630_907494637 -1 Left 907494630 1:54835764-54835786 CCACCTCCCCAGAGTTACAGGGC 0: 1
1: 1
2: 8
3: 40
4: 234
Right 907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG 0: 1
1: 0
2: 2
3: 43
4: 408
907494633_907494637 -8 Left 907494633 1:54835771-54835793 CCCAGAGTTACAGGGCAGCCTGA 0: 1
1: 0
2: 10
3: 158
4: 2424
Right 907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG 0: 1
1: 0
2: 2
3: 43
4: 408
907494626_907494637 24 Left 907494626 1:54835739-54835761 CCAGCTTCATGGGGAGGGCACTC 0: 1
1: 0
2: 2
3: 18
4: 145
Right 907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG 0: 1
1: 0
2: 2
3: 43
4: 408
907494632_907494637 -7 Left 907494632 1:54835770-54835792 CCCCAGAGTTACAGGGCAGCCTG 0: 1
1: 1
2: 2
3: 73
4: 1011
Right 907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG 0: 1
1: 0
2: 2
3: 43
4: 408
907494628_907494637 0 Left 907494628 1:54835763-54835785 CCCACCTCCCCAGAGTTACAGGG 0: 1
1: 1
2: 1
3: 10
4: 190
Right 907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG 0: 1
1: 0
2: 2
3: 43
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907494637 Original CRISPR CAGCCTGAGAAGAGGGATGA AGG Intronic
900869497 1:5291919-5291941 CAGCCAGAGAAGAGGGCCGTGGG - Intergenic
901226066 1:7613703-7613725 CAGCCTGAGGAGAGCGATGGCGG + Intronic
902110759 1:14076318-14076340 CACACTGTGAAGAGAGATGAAGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902114011 1:14106433-14106455 GGGCTTGAGAAGAGGGATGTGGG - Intergenic
902282532 1:15384842-15384864 CAGCCTGCGAGGAGGGCTGCCGG + Intronic
902594265 1:17497453-17497475 GAGACTCAGAAGAGGGAGGATGG - Intergenic
903150236 1:21402646-21402668 CAGCAGGAGAAGAGGTTTGAAGG - Intergenic
903190457 1:21652962-21652984 CAGCCGGGGATGAGGGAGGAAGG + Intronic
904910795 1:33932685-33932707 CAGCCAGAGATAAGTGATGAGGG - Intronic
906051632 1:42879457-42879479 TGGACAGAGAAGAGGGATGAGGG - Intergenic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907973426 1:59407360-59407382 CCGCCTGAGAAAAGGGAGGAGGG + Intronic
908168028 1:61477271-61477293 CAGCCTGAGCAGGGTGATGTAGG + Intergenic
909136586 1:71808478-71808500 AAGCCTGAGAAGAGAGGTTAGGG + Intronic
909225004 1:73008295-73008317 CAGCATGAAAAGAGGTATAATGG + Intergenic
909366491 1:74829449-74829471 CAGCACATGAAGAGGGATGAGGG - Intergenic
909436671 1:75650197-75650219 GAGGCTGGGAAGAGGGCTGAGGG - Intergenic
909961317 1:81847170-81847192 CAGCCGCAGAAGAAAGATGATGG + Intronic
911042990 1:93606740-93606762 CAGCATGAGAAGAGGGCTGGGGG + Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915166693 1:153951960-153951982 CTGCCTGACTGGAGGGATGAAGG - Intronic
915169778 1:153969509-153969531 CAGACAGAGCAAAGGGATGAGGG + Intronic
915357826 1:155266892-155266914 GAGGCTGAGAAGAGAGATGGGGG + Exonic
917311775 1:173686115-173686137 CAGCCTGAGGAGAGTCAGGAGGG + Intergenic
917450511 1:175143955-175143977 GGGCTTGAGAAGAGGTATGAAGG + Intronic
917452119 1:175155945-175155967 CAGCCTCAAAAGAGGGCTGGAGG + Intergenic
917568402 1:176235895-176235917 CAGTATGGGAAGAGGGGTGATGG + Intergenic
919486755 1:198156741-198156763 CAGCCGGGGAAGAGGGCTCAGGG + Intergenic
920127889 1:203708209-203708231 CAGCGTGAGAAATGGGATGTGGG - Intronic
920173303 1:204084699-204084721 GGGCCTGAGAGGAGGGAGGAAGG - Intronic
920507843 1:206529254-206529276 CAGGCTGAGAAGAGAGCTGCCGG + Intronic
920850499 1:209625077-209625099 CAGCCTGAGAAGAATGAAAATGG - Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921815981 1:219563888-219563910 CAACCTGAGAATAGGGATAATGG - Intergenic
922351496 1:224737824-224737846 CAACCTGAGAAGTGGGGTGATGG - Intronic
922412162 1:225387509-225387531 TAGCAAGAGAAGAGGGCTGAAGG + Intronic
923304338 1:232674399-232674421 CTGCCTGAGAAGAGGGACTGAGG - Intergenic
923554934 1:234993112-234993134 CAGCCTGAGAACCAGGGTGAAGG + Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
923990111 1:239426961-239426983 CAGGCTGAGAAATGGGTTGAAGG + Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924311438 1:242747723-242747745 CAGCCTGAGAATGGAAATGATGG - Intergenic
924578969 1:245306745-245306767 AAGGCTTATAAGAGGGATGAAGG - Intronic
1063391496 10:5652646-5652668 CAGCCTGAGCAAATTGATGATGG - Intronic
1064240203 10:13620561-13620583 CAGGCTGGGAACAGGCATGAAGG - Intronic
1065211371 10:23406653-23406675 CAGCTTGAGAAGGAGGAAGAGGG + Intergenic
1067169603 10:43895816-43895838 AAGCATGAGCAGAGGGATAAGGG + Intergenic
1068671813 10:59730648-59730670 CAGTCTGAGGAGAGTCATGAGGG + Intronic
1069635397 10:69921879-69921901 CAGGGTGAGAAGGGGGCTGAAGG + Exonic
1070808594 10:79285903-79285925 CAGCCTGAGAAGAGGCACAGAGG + Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1073991702 10:109268811-109268833 TAGCCTGAGGAGTGGGAGGATGG + Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075307102 10:121377855-121377877 CAGCTTGAGAAGAGGCACCAAGG - Intergenic
1075911708 10:126130736-126130758 TGGCCTGGGAAGAGGGATGGAGG + Intronic
1076440327 10:130477022-130477044 CTACCTGGGAAGAGGGATGATGG - Intergenic
1076768852 10:132651976-132651998 CATCCTGAGCACAGGGGTGAGGG - Intronic
1077159657 11:1106961-1106983 CACCCTGAGCAGAGTGCTGAGGG - Intergenic
1077302143 11:1852319-1852341 CAGCCCGAGGGGAGGGATGGAGG - Intergenic
1079290218 11:19181359-19181381 CATCCTAAAAAGAGGGATGGAGG + Intergenic
1079341333 11:19613997-19614019 CAACCTGATAATAGGGCTGAAGG + Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1080487130 11:32720819-32720841 TTGCCTGGGAAGAGGCATGAGGG + Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081539974 11:44027260-44027282 CAGCCAGAGGAGAGAGATGTGGG + Intergenic
1083205336 11:61145427-61145449 CAGCCTGAGATGCTGTATGAGGG - Intronic
1083743900 11:64724718-64724740 CAGCCTGTGAAGGGGTAAGAGGG + Intergenic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1084419173 11:69051799-69051821 CAGCCTGAGTAAAGGGTTGGAGG + Intronic
1084974208 11:72787712-72787734 CAGCCTGAGCACAGAGCTGAAGG - Intronic
1085391458 11:76184406-76184428 CAGCTTGAGAAGGAGGGTGATGG + Intergenic
1086573022 11:88306631-88306653 CAGCCAGAGAAGGAGGATGGAGG - Intronic
1088077444 11:105868206-105868228 CAGCCAGAGAAAAGGGGTAAGGG + Intronic
1088236471 11:107730066-107730088 CAGACTTGGAAGAGGGATGGTGG - Intergenic
1089851191 11:121498027-121498049 CAGAATGAGAAGAGAGATGTGGG + Intronic
1091402583 12:189732-189754 CAGCCACAGAAGAGGCATGTGGG + Intergenic
1093059928 12:14591164-14591186 CAGTCTGTGATGAAGGATGAAGG - Intergenic
1093546107 12:20350798-20350820 CAGCCTGGTGAGAGGGGTGAAGG - Intergenic
1093594130 12:20941218-20941240 CAGTCTGAGAAGAGTCAGGAGGG + Intergenic
1096157125 12:49346930-49346952 CAGGCCGAGATGAGGGCTGAGGG + Exonic
1096619386 12:52853309-52853331 CAGCCAGAGAAGGTGGATGAAGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097046678 12:56191851-56191873 CAGCCTGAGCAGTGGTATGAAGG - Intergenic
1097535420 12:60863828-60863850 CAGGATAAGATGAGGGATGAAGG + Intergenic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1101023992 12:100582894-100582916 CAGGCTGTGAAGACGGAGGAGGG - Intronic
1101668672 12:106845673-106845695 CAGCTTGAGAAGTGGGATAAGGG - Intronic
1101853686 12:108424656-108424678 GAGCTTGAGAATTGGGATGAAGG - Intergenic
1101951462 12:109179398-109179420 GTGCCTAACAAGAGGGATGAGGG + Intronic
1101995237 12:109520684-109520706 CAGCGGGAGATGAGGGGTGATGG + Intronic
1102516118 12:113448010-113448032 AAGGCTGAGAACAGGGCTGAGGG - Intergenic
1103520331 12:121533643-121533665 CAGCCAGAGAAGATGAATGCTGG + Intronic
1104288986 12:127451249-127451271 GAGCCTGAGATGAGGGGTGGAGG + Intergenic
1104391045 12:128390762-128390784 CAGCCTGGGAAGAGCGAAGCCGG + Intronic
1106115210 13:26811847-26811869 CAGCCTGGGAAGAGGGGCCACGG - Intergenic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1108334400 13:49424160-49424182 CAGCATGAAAAGAGGGGTAATGG + Intronic
1108434721 13:50390371-50390393 CAGTCTGGCAAGAGTGATGAAGG - Intronic
1108533505 13:51348373-51348395 CAGCCTGAGGAGAGCCAGGATGG + Exonic
1108584605 13:51859379-51859401 CAGCCTGAGGTGAGAGATTATGG - Intergenic
1110194571 13:72772737-72772759 CAGCCTGTGAAAAAGGCTGATGG + Exonic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1111984778 13:95054795-95054817 AAGCCTGAGAAGAGAGATAAAGG + Intronic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1112427830 13:99319849-99319871 CAGCCTGAGAACAGCAAAGAAGG + Intronic
1112769172 13:102776775-102776797 CTGGCTGAGAAGATGGAAGAGGG + Intergenic
1113611135 13:111645724-111645746 CAGGCTGAGCAGGGGGCTGATGG + Intronic
1114257129 14:21012645-21012667 CAGGATGGGAAAAGGGATGAGGG + Intergenic
1114832131 14:26157309-26157331 CAGAAGGAGAAGAGAGATGAAGG - Intergenic
1114967504 14:27981366-27981388 CATCCTGAGAGGAGAGCTGAGGG + Intergenic
1115337351 14:32255107-32255129 CAGTCCTAGAAGAGGGCTGAAGG - Intergenic
1115447281 14:33505816-33505838 CAGCCTGGGAAGAGGGGAGATGG - Intronic
1115682137 14:35752612-35752634 CAGTCTGAGAGGAGTGAGGAGGG + Intronic
1116372148 14:44149859-44149881 GAGCTTGAGGAGAGGTATGAAGG - Intergenic
1117762149 14:59040514-59040536 CAGACTGGGAAGAAAGATGAAGG + Intergenic
1117836771 14:59815929-59815951 CACCCTGAGCAAAGGCATGAAGG - Intronic
1118011984 14:61618784-61618806 TAGCATGAGAAGAGAGTTGAAGG - Intronic
1118356148 14:65015516-65015538 CAGCCTGGCAAGGGGGAGGAGGG - Intronic
1118761213 14:68881245-68881267 CAGCCTCAGAAAGGGGATGCAGG + Intronic
1118916935 14:70115592-70115614 GTGCCTGAGGAGAGGGACGATGG + Intronic
1119651747 14:76388818-76388840 CAAGCTGAGAAGAGGGAAGTCGG - Intronic
1121358210 14:93232350-93232372 CTGCCTGGGAGGAGGGAGGAAGG - Intergenic
1121712720 14:96051511-96051533 CATGCTGAGGAGATGGATGAGGG - Intronic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122660683 14:103293009-103293031 CAGTCTGAGGACAGAGATGAGGG + Intergenic
1123737190 15:23196705-23196727 AAACATGAGAAGACGGATGATGG + Intergenic
1123874443 15:24609599-24609621 GAGCATGAGAAGAGGGCTGTGGG + Intergenic
1124288406 15:28425367-28425389 AAACATGAGAAGACGGATGATGG + Intergenic
1124294818 15:28491947-28491969 AAACATGAGAAGACGGATGATGG - Intergenic
1124934453 15:34157041-34157063 CAGTCTGAGAAGAGCTAGGAAGG + Intronic
1125351144 15:38768815-38768837 AAGCCTTGGAAGAGGGTTGAGGG - Intergenic
1126105660 15:45145357-45145379 CAGGCTGAGATGAGTGAGGATGG - Intronic
1126194440 15:45916728-45916750 CAGCCTGAGATGAGGCAAGGAGG - Intergenic
1126603423 15:50451832-50451854 CAGTCTGAGAATGGGCATGAGGG + Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1127885459 15:63195774-63195796 TAGCATGAGAAGAGGGTTGGGGG + Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129335817 15:74851517-74851539 CAGCCTCAGAAGGGGCATCAAGG + Intronic
1131228754 15:90645808-90645830 CAGGCTGAGAAGAGGGGACACGG - Intergenic
1131271472 15:90950042-90950064 AAGCCTGGGGAGAGGGAGGAAGG + Intronic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131711006 15:95056613-95056635 AAGGCTGAGACGAGGGGTGAGGG - Intergenic
1132046173 15:98564493-98564515 CAGCCTGAGCTGAGGCATCAGGG + Intergenic
1132816801 16:1832915-1832937 CAGCCACAGAGGAGGGATGCAGG - Intronic
1132875371 16:2134846-2134868 TATCCTGAGAACAGGGGTGAGGG - Intronic
1134395118 16:13855418-13855440 AGGCCTCAGAAGACGGATGATGG - Intergenic
1134414587 16:14032585-14032607 GAACCTGAGAAGGGGGATTATGG + Intergenic
1134519613 16:14912514-14912536 TATCCTGAGAACAGGGGTGAGGG + Intronic
1134554318 16:15153721-15153743 TATCCTGAGAACAGGGGTGAGGG - Intergenic
1134707285 16:16311170-16311192 TATCCTGAGAACAGGGGTGAGGG + Intergenic
1134960256 16:18400955-18400977 TATCCTGAGAACAGGGGTGAGGG - Intergenic
1135522123 16:23185867-23185889 CTGCCTGATAAGAGAGCTGATGG + Intronic
1137734852 16:50716245-50716267 CAGCCTCACAAAGGGGATGATGG - Intronic
1137754352 16:50889601-50889623 CAGTCTGAGCAGGGTGATGAAGG - Intergenic
1138119888 16:54391555-54391577 CAGCATGAGGAGAGTGATTAAGG + Intergenic
1138397904 16:56720368-56720390 TTGCCTGGGAAGAGGAATGAAGG - Intronic
1138586365 16:57972848-57972870 CAGCCTGACGGGAGGGATGATGG + Intergenic
1138868142 16:60848889-60848911 CAGACAGAGAAGAGTGATTACGG - Intergenic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140693125 16:77503858-77503880 GAGACAGAGAAGAGGGAGGAGGG + Intergenic
1142264797 16:89058714-89058736 CAGCCTGAGACGAGGCCTGGAGG + Intergenic
1142759815 17:2035727-2035749 GAGCCTGGGTAGAGGAATGAGGG + Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143363209 17:6388056-6388078 CAGAGTGAGAAGGGGGATGTGGG + Intergenic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1144210483 17:13010645-13010667 TAGCCAGAGAAGAGGGGTCAGGG - Exonic
1144456485 17:15423071-15423093 GAGCCTGAGAAGAGGGTTGGAGG + Intergenic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1146260311 17:31416420-31416442 CGGCCTGAGACAAGGGATGAGGG - Intronic
1146265514 17:31450263-31450285 CAGCCTGAGAGGTAGGAGGAAGG - Intronic
1147718272 17:42522351-42522373 CAGCCTGGGAGAGGGGATGAGGG - Exonic
1148000390 17:44384256-44384278 CAGCCTGAGAACTGGGATAAGGG + Intronic
1149190946 17:54061011-54061033 CAGCCAGAGAAGAAGGAGTAAGG - Intergenic
1151676472 17:75601393-75601415 CAGCCTGTGCAGAGGCGTGAAGG + Intergenic
1152104758 17:78322575-78322597 AAGCCTGAGACCAGGGATGGAGG - Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152607775 17:81301681-81301703 CCGTCTGGGAAGAGGGATGGAGG + Intergenic
1152617081 17:81342949-81342971 CCGCCTGAGAAGGGGGCGGAAGG - Intergenic
1153330199 18:3866057-3866079 CAGCTGGAGAAAAGGTATGAAGG + Intronic
1153838997 18:8989600-8989622 CAGGCTGAGTAGAGGCATCAAGG + Intergenic
1155055199 18:22176626-22176648 CAGCCTGAGAGTAGGGGTCAGGG + Intronic
1155101296 18:22612965-22612987 CAAGCAGAGAAGAGCGATGAAGG + Intergenic
1155676054 18:28430078-28430100 CCACCTGAGAAGAGGGATTATGG + Intergenic
1155936986 18:31764330-31764352 CAGCCTGAGAAGGGTGACAATGG - Intergenic
1156408104 18:36801909-36801931 GAGTCTGAGAAGAGGGGTCAGGG - Intronic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158299469 18:56035288-56035310 CACACTGAGCAGAGGGGTGAAGG - Intergenic
1159133043 18:64302958-64302980 CATCCTAAGAAGAAGGATGGGGG + Intergenic
1160057381 18:75496291-75496313 CAGCCTAAGAAGCAGGAAGATGG + Intergenic
1160357265 18:78238982-78239004 CGGCCTGAGAAGAAGGAAGGAGG + Intergenic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161381658 19:3968664-3968686 AAGCATGAGAAGGGGGAGGAGGG + Intronic
1162366303 19:10251756-10251778 CAGCCTTGGAGGCGGGATGAAGG + Intergenic
1163894541 19:20046492-20046514 CAGCCTGAGTCCAGGGAGGACGG + Intergenic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166346761 19:42171136-42171158 CAGCCTGAGCAGTGTGCTGAGGG - Intronic
1166882142 19:45936111-45936133 CCCCCTGAGATGGGGGATGAAGG + Exonic
1166988068 19:46674234-46674256 CTGCCTGAAAAGAGGAAGGATGG - Intergenic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1168072090 19:53959040-53959062 CATCCAGAGAGGAGGGAGGAGGG - Intergenic
1168517069 19:57017533-57017555 CAGAGGGAGAAGGGGGATGAGGG - Intergenic
925024896 2:599877-599899 CACCCAGAGGAGAGGGAAGAGGG + Intergenic
925043870 2:755930-755952 CATCCTCAGCAGAGGGATCAGGG + Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926072481 2:9909422-9909444 GAGCCTGAGATGAGGAATGGGGG + Intronic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926153781 2:10439387-10439409 GAGCCTGAGAAGTAGGATGCTGG - Intergenic
926308812 2:11659755-11659777 CAGCCTGGGAAGAGGGAGCACGG - Intronic
926547558 2:14260634-14260656 CAGCTTGAGGAAAGGGATGAGGG + Intergenic
926550871 2:14299529-14299551 CTGCCTTAGCAGAGGTATGAGGG - Intergenic
927922766 2:26986190-26986212 CAGTCAGAGAACAGTGATGATGG - Intronic
928241749 2:29592512-29592534 CTACCTGGGAAGAGGGATGCTGG + Intronic
929136116 2:38625311-38625333 TTGCATGAGAAGAGGGCTGAAGG - Intergenic
929279766 2:40065103-40065125 CAACCTGAGAAGAATGATGCCGG - Intergenic
929555130 2:42921220-42921242 CAGTCTGAGAAGGGAGATAAGGG + Intergenic
930088967 2:47518182-47518204 TGGCCTGAGATGAAGGATGATGG + Exonic
931296130 2:60927851-60927873 CAGACTGGGAAGGGGCATGAAGG - Exonic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
933871373 2:86568765-86568787 CTGCCTGAGAATGGGCATGAAGG - Intronic
934173671 2:89560473-89560495 CAGCCTGAGAAGATGCTTGGCGG + Intergenic
934283985 2:91634822-91634844 CAGCCTGAGAAGATGCTTGGCGG + Intergenic
934605224 2:95689995-95690017 GCGCCTGAGCAGAGTGATGATGG - Intergenic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
936713808 2:115162089-115162111 CAGCCTGGGAAGCGGGAGGCGGG - Intronic
937466795 2:122139816-122139838 GGGCCAGAGAAGAGGGAAGAAGG + Intergenic
937984521 2:127632551-127632573 CTGCCAGAGAAGAGGGTGGAGGG + Intronic
938658825 2:133464740-133464762 TAGCCTGAGATGTGGGAAGAAGG + Intronic
940470400 2:154090549-154090571 CAGACTGAGAAAAGTGCTGAAGG - Intronic
941470382 2:165878399-165878421 TAACCTGAGAATAGGTATGAAGG + Intronic
941473782 2:165923074-165923096 GAGACTTAGAAGAGGGAGGATGG + Intronic
941873358 2:170408689-170408711 CAGCCAGTTAAGAGGGATGTGGG - Intronic
943258811 2:185631465-185631487 ATCCCTGAAAAGAGGGATGAAGG + Intergenic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
945275888 2:207987269-207987291 CAGCCTTAGAGGAGGGAGTAGGG - Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945720272 2:213410380-213410402 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
945969370 2:216221143-216221165 CAGCCTGACAAGTGGGCTGAGGG - Intergenic
945976671 2:216276514-216276536 CAGCCAGAGACCAGGGATGCTGG - Intronic
947378591 2:229523069-229523091 CATCCTGAGAAAGGTGATGAGGG + Intronic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947955658 2:234188341-234188363 GACCCTGAGAAGGGGGATGAAGG - Intergenic
948457284 2:238110881-238110903 CAGCCTCTAAAGAGGAATGATGG + Intronic
948878096 2:240840868-240840890 CACCCTGAGAAGAGGCGTGTTGG - Intergenic
1170087115 20:12546009-12546031 CAGCAAGAGAAGAGGAATGAAGG - Intergenic
1170634756 20:18094394-18094416 AAGACTGATAAGAGGCATGAGGG + Intergenic
1171400959 20:24872764-24872786 CACCCTGTGAGGAGGGATGGGGG + Intergenic
1172022236 20:31923143-31923165 CAGCCTGACACCAGGCATGAAGG + Intronic
1175000903 20:55630000-55630022 CAGCCAGTGAAGGGGGGTGAAGG - Intergenic
1176811299 21:13540850-13540872 CAGTCTGAGAAGAGCCAGGAAGG + Intergenic
1179553460 21:42157813-42157835 CTGCCTTTGAAGAGGGAGGAGGG - Intergenic
1179766794 21:43580047-43580069 AGGCCTGAGCAGAGGGATGTAGG - Intronic
1179802321 21:43816770-43816792 CAGCCTAGGAGGAGGGCTGAGGG + Intergenic
1182497344 22:30718820-30718842 CAGCATGGGAACAGGGCTGATGG + Intronic
1183414044 22:37672611-37672633 CAGCCTGGGAAGAGACAAGAAGG + Intergenic
1183512374 22:38243697-38243719 CAGCCTGCGAGGAGGGAGCATGG + Intronic
1183789607 22:40055378-40055400 CAGCCTGTGTAGAGGCATGGGGG + Intronic
1183832564 22:40426143-40426165 AGGCCTGAGAAAAGGGCTGATGG - Intronic
1183878163 22:40802185-40802207 CTGGCAGAAAAGAGGGATGAAGG - Intronic
1184383431 22:44160706-44160728 CAGCCTGAGAAGAAAGCAGAAGG + Intronic
1184490708 22:44807192-44807214 CAACCTGAGCTGAGGGATCATGG + Intronic
1184995582 22:48205186-48205208 CTGCCTGAGAATTGGGAAGAGGG + Intergenic
1185203576 22:49523480-49523502 CAGCCTGGGAAGAGCCAGGAAGG - Intronic
949803482 3:7928936-7928958 CAGCCAGAGAAAAAGTATGAAGG - Intergenic
949984950 3:9533193-9533215 CAGCCTGAAAAGAGGGGTCTGGG - Intronic
950129746 3:10533982-10534004 CAGCCTGGGAAGAGAGCTGCTGG - Intronic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950622218 3:14215131-14215153 CAGCTGGAGAAGAGGGAGGGTGG - Intergenic
950863208 3:16168824-16168846 TCCCCTGAGAAGAGGGATGTGGG + Intergenic
950887725 3:16375635-16375657 CAGCCTGAGCAGAGAGATAAAGG + Intronic
953229825 3:41054895-41054917 CAGCCTGTGGAGAGACATGAAGG + Intergenic
953521544 3:43647956-43647978 CAGCCAAAGTAGAGAGATGAGGG - Intronic
954449553 3:50564254-50564276 CAGGCTGAGACTAGGGAGGATGG - Intronic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
958784011 3:98577115-98577137 CAGCCTGAGAAAAGGCCAGAGGG + Intronic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959533779 3:107463003-107463025 CACCCTGAAAAGAGGTAGGAAGG + Intergenic
959691971 3:109207555-109207577 AAGCCTGAGAGGAGGTCTGAGGG - Intergenic
960704378 3:120468172-120468194 AGGCCTGGGAAGAGGTATGAGGG + Intergenic
962229517 3:133649679-133649701 CTGCATGACAAGTGGGATGATGG - Intronic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
962987598 3:140549777-140549799 CAGCCAGAGAGGTGGGAGGAGGG - Intronic
962987761 3:140551232-140551254 CAGCCAGAGAGGTGGGAGGAGGG - Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
965155170 3:165042284-165042306 CAGCCTGGAAGGAGGCATGATGG - Intronic
966716579 3:183018734-183018756 CAGAGAGGGAAGAGGGATGAGGG + Intronic
966942549 3:184756172-184756194 CAGCCTGAAAGGGGGGATTAAGG - Intergenic
967292607 3:187935946-187935968 AATAGTGAGAAGAGGGATGAGGG + Intergenic
967856009 3:194118080-194118102 CAGTCTGAGAAGGGAGATGAGGG - Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968432751 4:568370-568392 GGGACTGAGAAGGGGGATGAGGG - Intergenic
968577839 4:1376217-1376239 CAGCCTGAGGAGGGGGCTGCCGG + Intronic
968619663 4:1598158-1598180 CAGCCGGAGAAGGGGCAAGAAGG - Intergenic
969433837 4:7172585-7172607 CAGCCTCAGGAAAGGGATGCAGG - Intergenic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
971455564 4:26840863-26840885 CAGGCTGAGAAGTGAGAAGAAGG - Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972571264 4:40312446-40312468 CATCCTAGGAAGAGGGAAGATGG - Intergenic
975468996 4:74743267-74743289 CAGCCTGGAACAAGGGATGAAGG + Intergenic
976318728 4:83687077-83687099 TAGCCTCAGAAGAGAGAGGAGGG - Intergenic
976730173 4:88253521-88253543 CACCATGAGAAGATGGTTGATGG + Intergenic
978951956 4:114571620-114571642 CAGCCTATTAAGAGGGGTGAAGG - Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
981971455 4:150667314-150667336 CATCCTTATAAGAGGGAGGAAGG + Intronic
982071835 4:151702342-151702364 CAGCTGGAGAAGAGGGAGGGAGG + Intronic
983092599 4:163522414-163522436 CTGCGTGAGAACAGGCATGAAGG - Intergenic
983633108 4:169870110-169870132 CAACCTTGGAAGAGGGAGGAAGG + Intergenic
984493150 4:180461450-180461472 CAAACTGAGAAGTGTGATGATGG - Intergenic
984943487 4:184953648-184953670 CAGCGTGAGAAGAGGAAGAATGG + Intergenic
986130145 5:4922597-4922619 CAGGCTGAGAAAATGAATGAAGG - Intergenic
986299681 5:6468123-6468145 CAGCATGAGAACAGGGACGGGGG - Intronic
987278217 5:16385092-16385114 CAGCATGAGAAAAGTTATGAAGG + Intergenic
987353025 5:17038072-17038094 CATCCTAAGAAGAGGGAAGTTGG + Intergenic
987916358 5:24220004-24220026 TAGACTCAGAAGAGGGAGGATGG - Intergenic
990487559 5:56274194-56274216 CAGGCAGAGAAGAGGAAAGAAGG - Intergenic
990728573 5:58784043-58784065 CATCCTGAGATAAGGGATGAAGG + Intronic
991257352 5:64629742-64629764 GAGCCTGACAGGAGGGAGGAGGG + Intergenic
991306063 5:65177450-65177472 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
991562056 5:67964301-67964323 CAGCCCCAGGTGAGGGATGAGGG - Intergenic
993074128 5:83205806-83205828 CAGGGTGAGAATAAGGATGAGGG + Intronic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
993222872 5:85124825-85124847 CACACTGTGAAGAGGCATGAGGG - Intergenic
994489961 5:100428480-100428502 AAGCCTGATAAGAGGGATAGAGG + Intergenic
995701115 5:114937071-114937093 AAGGCTGAGAAAAGGGAAGAAGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997463982 5:134074506-134074528 CACCCCGAGAAGAGGGAAGAGGG + Intergenic
998730074 5:145064742-145064764 CAGGCTTTGAAGAGGGAGGATGG + Intergenic
999889299 5:155959321-155959343 GAACCTGAAGAGAGGGATGAAGG - Intronic
1001200909 5:169715766-169715788 CTGGCTGAGAAGGGGTATGAGGG - Intronic
1001252229 5:170155180-170155202 AAGCATGAGGAGAAGGATGAGGG + Intergenic
1002542070 5:179913040-179913062 CAGCCTGAGGAGAGCAAAGATGG + Intronic
1002985069 6:2181773-2181795 AGGCCTGAGGAGAGGGAAGAGGG - Intronic
1003055210 6:2812109-2812131 CTGCCTGAAAACGGGGATGAGGG + Intergenic
1003518981 6:6841664-6841686 CAGCCTGAGAAGCGGCTTGGAGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1006057189 6:31393979-31394001 GATCCTGTGATGAGGGATGAGGG + Intergenic
1006324023 6:33339668-33339690 CAGACTGAAAATGGGGATGAGGG + Intergenic
1006442175 6:34059574-34059596 CAGCATGTGCAGAGGGGTGAGGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1007387358 6:41528830-41528852 CAGCCTGGTGAGAGGGATGCGGG + Intergenic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1010083573 6:71889194-71889216 CAGCCAATGAAGAGGCATGATGG - Intronic
1011093743 6:83635364-83635386 CAGCCAGAGATGAGAGATTAGGG - Intronic
1011214157 6:84987367-84987389 CATCCAGTGAGGAGGGATGAAGG - Intergenic
1011716029 6:90105998-90106020 GAGCTTCAGAAGAGGGAAGAAGG + Intronic
1012536188 6:100300231-100300253 AAATCTGAGAAGAGGGTTGAGGG - Intergenic
1013367139 6:109444992-109445014 GAACCTGAGAAGAAGGAAGATGG + Exonic
1014161542 6:118175284-118175306 CAGCCTGAGAAATGAGATCAAGG - Intronic
1014329737 6:120047708-120047730 GAGCCTTAGAAAAGTGATGAGGG - Intergenic
1016053356 6:139553249-139553271 CAGCTTGAGAAAAGGAAAGAGGG + Intergenic
1017051558 6:150398346-150398368 CCACCTGAGAAGAGCAATGAGGG - Exonic
1017324102 6:153127479-153127501 CAGACATACAAGAGGGATGAAGG - Intronic
1017457951 6:154619682-154619704 CATCCTGTGTAGGGGGATGAAGG + Intergenic
1017815353 6:158012246-158012268 CAGCCTGGGAAGGAGGATGTGGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018674238 6:166205359-166205381 CTTCCTGAGAAGAGGGCTGGCGG + Intergenic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1019550965 7:1602322-1602344 CAGCCTCGGATCAGGGATGACGG + Intergenic
1020246572 7:6434024-6434046 CAGCCTCCGTAGAGGGAAGAGGG - Intronic
1021906392 7:25338478-25338500 CAGCCTGAGCAGGGGAATGGGGG + Intergenic
1022567265 7:31415898-31415920 CAGCATGGGAAAAGGGTTGATGG - Intergenic
1023567231 7:41535461-41535483 CAGCCAGAGTGGTGGGATGAAGG + Intergenic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1028752067 7:94393647-94393669 CGGCCAGAGAAGAGGGAAGTTGG + Intergenic
1029033591 7:97494675-97494697 CAGCCTGAGAAAAAGTGTGAAGG + Intergenic
1029176239 7:98666571-98666593 CACCCTCTGAAGAGTGATGAAGG + Intergenic
1029960804 7:104687624-104687646 AAGCCAAAAAAGAGGGATGAAGG + Intronic
1031065543 7:117101097-117101119 CAAACAGAGGAGAGGGATGATGG + Intronic
1031199911 7:118668910-118668932 CAGCCTGAGAAGGGGGGTTGAGG - Intergenic
1031813587 7:126404171-126404193 CAGCCAGAGAAGAAGGAAGAAGG - Intergenic
1032534813 7:132653968-132653990 CTGCCTGAGAAGATGGTGGAAGG + Intronic
1033269882 7:139921217-139921239 TTGACTGAGAAGAGGCATGAGGG - Intronic
1033659414 7:143393406-143393428 CTGCCTGAGAAGAGAAAAGATGG + Intronic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1033792921 7:144813978-144814000 AAGGCTGAGAAGAGGGAAAAGGG + Intronic
1033874209 7:145794421-145794443 CACCTTGAGAACAGGTATGAGGG - Intergenic
1034033806 7:147798958-147798980 CAGGCAAAGAAGATGGATGATGG + Intronic
1034778369 7:153853171-153853193 CAGACAGAGAAGAGGGGTCAAGG - Intergenic
1034953637 7:155318163-155318185 CATCCTGATAATAGTGATGATGG - Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1036750896 8:11443259-11443281 CAGCCTGAGAACAGGGTGGGGGG - Intronic
1037823301 8:22146218-22146240 CAGACTGAGAAGCGGGTTGGTGG + Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038319799 8:26515263-26515285 CAGCGTGAGAAGAGCCAGGAAGG + Intronic
1039058360 8:33554414-33554436 CAGCCAGACAAGAGGCATGATGG - Intronic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1039897297 8:41725429-41725451 CAGCCGGGGAGGAGAGATGAAGG + Intronic
1040482271 8:47836914-47836936 CAGCCTAAACAGTGGGATGATGG - Intronic
1041515449 8:58694667-58694689 CAGTCTGAGAAGAGTCAGGAGGG - Intergenic
1041834298 8:62194665-62194687 CAGCCTGAGAAGGGGTTTCAGGG + Intergenic
1042865020 8:73349407-73349429 TGCCCTGAGAAGAGGGATGCAGG - Intergenic
1042877381 8:73451646-73451668 CACCCTGAGAAGAGCAATTAAGG - Intronic
1044619940 8:94179543-94179565 CAGCCAGAGGTGAGGGATTAGGG - Intronic
1045775506 8:105797742-105797764 CAGCCTGAGCTGAGGTATGAAGG - Intronic
1046584046 8:116129672-116129694 GAGGCTGAGAAGAGGGAGAAGGG + Intergenic
1047218064 8:122895094-122895116 GACCCTGGGGAGAGGGATGAGGG - Intronic
1047298870 8:123596002-123596024 CAGCCAGTGAAGAAGGAGGAGGG + Intergenic
1047305493 8:123649762-123649784 TAGCCTGAGAAGGGGGCTGATGG + Intronic
1047670018 8:127135953-127135975 CAGAGTGAGAAGAGGGCTGGAGG - Intergenic
1048157135 8:131967412-131967434 CAGCCTGAAAACAGGGCAGAGGG + Intronic
1048176178 8:132154608-132154630 CAGCCTGTGCAATGGGATGATGG + Intronic
1048258611 8:132925595-132925617 CTGCCCAAGAAGAGGGATGTTGG - Intronic
1049069792 8:140347488-140347510 CAGGCTGAGGACAGGGCTGAAGG - Intronic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049568440 8:143355929-143355951 CACTCTTAGAAGAGGGATAAAGG + Intronic
1049610743 8:143553638-143553660 CAGCCTGGGAGGAGGGAGGGAGG - Exonic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050251816 9:3752826-3752848 CAGACTGACAACAGGGATGCTGG - Intergenic
1051198416 9:14588835-14588857 CAGCCTGAGAAAAAGCATAAAGG + Intergenic
1051369811 9:16348681-16348703 CCGCATGAGGAGAGGCATGAGGG + Intergenic
1053151110 9:35743747-35743769 AAGCTTCAGAAGAGGGAAGAAGG + Intronic
1054840301 9:69731210-69731232 GAGCATGGGAAGAGGGATGTAGG + Intronic
1055075739 9:72213314-72213336 CAGCCTGAGAATGGGGATGGGGG + Intronic
1055723860 9:79206452-79206474 CACCCTGAGAAAAGGGAAGATGG + Intergenic
1056210760 9:84362763-84362785 CATTCTGAGAAGAGGGCTGTAGG - Intergenic
1056534977 9:87519249-87519271 AAACCTGAGAAGAGGAATGAAGG - Intronic
1057561480 9:96131286-96131308 CTCACTGAGAAGAGGGATCAGGG + Intergenic
1057605018 9:96492841-96492863 CAGCCTGGGAAGAGGCAGGCTGG + Intronic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059935365 9:119304875-119304897 CAGCCTGAGGAGTGGGAGAAAGG - Intronic
1060265844 9:122111068-122111090 CAGCCTGGGCAAGGGGATGAGGG + Intergenic
1060468688 9:123930003-123930025 CAGCCTGAGGGAAGGGAGGAAGG - Exonic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1060863711 9:126978015-126978037 GAGCCTGGGAAAAGGAATGAGGG - Intronic
1061263728 9:129494020-129494042 CAGCCGGATAAGGGGGATAAGGG + Intergenic
1061418168 9:130459287-130459309 CAGCTTGGGAAGATGGAGGACGG - Intronic
1062091004 9:134678853-134678875 GAGCCTGGGAAGAGGGAGCAGGG + Intronic
1062567786 9:137170964-137170986 CCACCTGAGTAGAGGGCTGAGGG - Exonic
1185680588 X:1885545-1885567 CAGGCTGAGAAGGTAGATGATGG + Intergenic
1185757901 X:2666677-2666699 CAGCCTGCCATGAGGTATGAAGG + Intergenic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186990323 X:15060142-15060164 CAGGCTGAGCAGATAGATGAGGG + Intergenic
1187249121 X:17581165-17581187 CACCCTGTGAAGAGGGATATTGG - Intronic
1190123653 X:47684488-47684510 TAGACTGAGAAGGGGCATGAGGG + Intergenic
1190221532 X:48515288-48515310 CAGACTGAGAAGAGGGATCGAGG + Intronic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1190817145 X:53938801-53938823 CAGGATGAGGAGAGGTATGAAGG - Exonic
1192221714 X:69201759-69201781 CAGCTTGAGATGAGCCATGATGG - Intergenic
1192245015 X:69364834-69364856 GAGTCTGAGAAGCGGCATGAGGG - Intergenic
1192790062 X:74372755-74372777 CTGCCTGGAAACAGGGATGAAGG - Intergenic
1196667849 X:118335007-118335029 TGACCTAAGAAGAGGGATGAGGG - Intergenic
1198070921 X:133147846-133147868 CAGCCAGAGATGAGAGATTAGGG + Intergenic
1199024770 X:142923422-142923444 CAGCATGACAAGAAGGATGAAGG - Intergenic
1200835450 Y:7727347-7727369 CAGCCTGAGCAGAGAGATAAAGG + Intergenic
1200954926 Y:8934514-8934536 CAGGCTGCCAACAGGGATGAAGG - Intergenic