ID: 907496931

View in Genome Browser
Species Human (GRCh38)
Location 1:54851521-54851543
Sequence GACTCAGTGGTGGCTGGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 632}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907496922_907496931 2 Left 907496922 1:54851496-54851518 CCAGGAACACAGGGCACTCCGAG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 907496931 1:54851521-54851543 GACTCAGTGGTGGCTGGGGTGGG 0: 1
1: 0
2: 4
3: 93
4: 632
907496918_907496931 17 Left 907496918 1:54851481-54851503 CCTGGAATGCCTTCTCCAGGAAC 0: 1
1: 1
2: 2
3: 34
4: 298
Right 907496931 1:54851521-54851543 GACTCAGTGGTGGCTGGGGTGGG 0: 1
1: 0
2: 4
3: 93
4: 632
907496917_907496931 18 Left 907496917 1:54851480-54851502 CCCTGGAATGCCTTCTCCAGGAA 0: 1
1: 0
2: 2
3: 26
4: 277
Right 907496931 1:54851521-54851543 GACTCAGTGGTGGCTGGGGTGGG 0: 1
1: 0
2: 4
3: 93
4: 632
907496921_907496931 8 Left 907496921 1:54851490-54851512 CCTTCTCCAGGAACACAGGGCAC 0: 1
1: 0
2: 1
3: 22
4: 319
Right 907496931 1:54851521-54851543 GACTCAGTGGTGGCTGGGGTGGG 0: 1
1: 0
2: 4
3: 93
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907496931 Original CRISPR GACTCAGTGGTGGCTGGGGT GGG Exonic
900174412 1:1285454-1285476 GCCACACTGGGGGCTGGGGTGGG + Intronic
900188839 1:1344933-1344955 GAGTCAGAGGGTGCTGGGGTTGG - Intronic
900384889 1:2406001-2406023 GTCCCAGTGGGGGCTGGGGCGGG + Intronic
900395536 1:2451794-2451816 GACGCAGTGGGGGCAGGGCTGGG - Intronic
900438738 1:2643158-2643180 GGCTCAGGGGAGTCTGGGGTCGG - Intronic
900572266 1:3364506-3364528 GGCTCAGTGGAGGCCTGGGTTGG - Intronic
900637057 1:3671187-3671209 GCCTCAGGGATGGCAGGGGTGGG + Intronic
901193827 1:7428595-7428617 GACTCAGGGGAGGATGTGGTAGG - Intronic
901434541 1:9238818-9238840 GACTCTGTGAGGGGTGGGGTTGG + Intronic
901748745 1:11392715-11392737 GACTCCCAGGTGGCTGAGGTGGG + Intergenic
901780967 1:11594226-11594248 CCCTCAGTGGTTGCTGGGGAAGG + Intergenic
902379914 1:16048080-16048102 GAGACTGGGGTGGCTGGGGTGGG - Intronic
902746917 1:18480739-18480761 GCTTCCCTGGTGGCTGGGGTGGG - Intergenic
902912963 1:19614605-19614627 GAGTGAGTGGTGGCTGGGCGCGG - Intronic
902984814 1:20148953-20148975 ACCTCAGTGAGGGCTGGGGTGGG - Exonic
904291305 1:29487781-29487803 GCCACAGTGAAGGCTGGGGTAGG + Intergenic
904587561 1:31588642-31588664 GACGCAGTGGAGGCTTGGGAGGG - Intergenic
905015699 1:34777092-34777114 GTCTGAGAGGTGGCAGGGGTGGG + Intronic
905028731 1:34867670-34867692 GACTTCGTGGAGGCTGGGGAAGG - Intronic
905134470 1:35787848-35787870 GAGACTGTGGGGGCTGGGGTAGG - Intergenic
905423264 1:37862923-37862945 GTGTCAGAGGTGGCTGAGGTTGG + Intronic
905499677 1:38426680-38426702 GACTCAGCGATGCTTGGGGTTGG - Intergenic
905653584 1:39672082-39672104 GACGCGGAGGTGGCTGGGGCTGG + Intergenic
906429965 1:45748558-45748580 TACTCAGGGGAGGCTGAGGTGGG + Intronic
906681615 1:47729980-47730002 GACCAAGTGGTGTCTGGGCTTGG + Intergenic
906744626 1:48213099-48213121 GACTCAGTGACGCTTGGGGTTGG + Intergenic
907496931 1:54851521-54851543 GACTCAGTGGTGGCTGGGGTGGG + Exonic
907503667 1:54901976-54901998 GACTCAGAGGCGCTTGGGGTTGG + Intergenic
908592053 1:65645992-65646014 GACTCAGTGATGCTTGGGGTTGG + Intergenic
909035373 1:70589911-70589933 GACTCAGCGATGCTTGGGGTTGG - Intergenic
909222751 1:72983924-72983946 GACTCAGTGACGCTTGGGGTTGG + Intergenic
909263852 1:73530944-73530966 CACTCAGTGCAGGCAGGGGTTGG - Intergenic
909788358 1:79642845-79642867 GACTCAGTGACGCTTGGGGTTGG + Intergenic
909793073 1:79700436-79700458 GACTCAGTGATGCTTGGGGTTGG + Intergenic
909978548 1:82071607-82071629 GACTCAGCGATGCTTGGGGTTGG + Intergenic
911277459 1:95879424-95879446 GACTTAGTGGTGACTGTGGGTGG + Intergenic
911510719 1:98805387-98805409 GACTCAGTGAAGCTTGGGGTTGG + Intergenic
911570306 1:99511239-99511261 GACTCAGCGATGCTTGGGGTTGG - Intergenic
911588573 1:99719467-99719489 GACTCAGTGCTGGCTGGATTAGG - Intronic
911759889 1:101602182-101602204 GACTCAGCGATGCTTGGGGTTGG + Intergenic
911983751 1:104597565-104597587 GACTCAGCGATGCTTGGGGTTGG - Intergenic
912296381 1:108474568-108474590 GACTCAGTGACGCTTGGGGTTGG - Intergenic
912759683 1:112356197-112356219 GAGTCAGTGGTGGATAGGGAAGG - Intergenic
912815421 1:112824639-112824661 GACTCAGCGATGCTTGGGGTTGG + Intergenic
914251111 1:145922213-145922235 GACTCTGTTGGGGGTGGGGTGGG + Intergenic
914933409 1:151955453-151955475 TACTCAGTGGAGGCTGAGGCAGG + Intergenic
915161299 1:153922628-153922650 GAGGCAGTGGTGGCGGAGGTGGG - Intronic
916824354 1:168429919-168429941 GACCCAGAGCTGGCTGTGGTGGG - Intergenic
916930859 1:169576736-169576758 GGCTCATTGGCAGCTGGGGTAGG - Intronic
917538453 1:175891490-175891512 AACTTAGTGGTGGCCAGGGTGGG + Intergenic
918347014 1:183615250-183615272 GACTCAGCGATGCTTGGGGTTGG - Intergenic
918556190 1:185802127-185802149 GATTTAGTGATGGCTTGGGTAGG + Intronic
919043790 1:192425364-192425386 GTCTCAGTGGTGGCAGTGGCAGG - Intergenic
919220683 1:194624921-194624943 GCCCCAGTGGGGGCGGGGGTGGG + Intergenic
919445846 1:197704131-197704153 GCCACTTTGGTGGCTGGGGTGGG + Intronic
919476300 1:198036395-198036417 GACTCAGCGATGCTTGGGGTTGG - Intergenic
920150838 1:203906077-203906099 ATTTCAGTGGTGGCTGGGGAGGG + Intergenic
921212318 1:212911107-212911129 GACTCAGCGATGCTTGGGGTTGG - Intergenic
921520031 1:216147149-216147171 GACTCAGCGATGCTTGGGGTTGG - Intronic
921701438 1:218272840-218272862 GACTGAAAGGTGGCTGGTGTGGG - Intergenic
922049636 1:221977214-221977236 GACTCAGCGATGCTTGGGGTTGG + Intergenic
922394486 1:225182617-225182639 GGCTCCGTGCTGCCTGGGGTTGG - Intronic
922503027 1:226110556-226110578 TCCCCAGTGGTGGCGGGGGTCGG - Intergenic
922906302 1:229176037-229176059 GACTCAGTGACGCTTGGGGTTGG - Intergenic
923075109 1:230602846-230602868 GACTCAGTGATGCTTGGGGTTGG - Intergenic
923244653 1:232119780-232119802 GACTCAGCGATGCTTGGGGTTGG - Intergenic
923257373 1:232233311-232233333 GACTCAGCGATGCTTGGGGTTGG + Intergenic
923281263 1:232445362-232445384 GACACAGTGGTGCCTGGGGTCGG - Intronic
923511755 1:234659228-234659250 GAGTCTGTGGTGGCAGAGGTGGG + Intergenic
923902239 1:238338938-238338960 CAATCAGTGGTTGCTGGGGTTGG - Intergenic
923902249 1:238338996-238339018 CAATCAGTGGTTGCTGGGGTTGG - Intergenic
1062909074 10:1200292-1200314 GCCCCAGTGATGGCTGGGTTGGG - Intronic
1063161209 10:3420289-3420311 GACCCAGTGGTAGCTGGGCAGGG + Intergenic
1063328613 10:5132168-5132190 GACTCAGTGTTGGGGGAGGTTGG + Intronic
1063509701 10:6633703-6633725 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1063527780 10:6801200-6801222 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1063613063 10:7579691-7579713 GGCTGAGGGGTGGCTGCGGTGGG - Intronic
1063644776 10:7868090-7868112 GTCTCAGGGGTGGCAGAGGTGGG + Intronic
1064362799 10:14680932-14680954 GACCCAATGATGGCTGGAGTGGG - Intronic
1065413726 10:25461225-25461247 GACATAGTGGAGGCTGGGATAGG + Intronic
1065437533 10:25718007-25718029 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1065959221 10:30720645-30720667 AGATCAGTGGTTGCTGGGGTTGG + Intergenic
1066001978 10:31113146-31113168 GACTCAGAGCTGCCTGGGCTTGG - Intergenic
1067518245 10:46973775-46973797 GTCACAGTGGTGTGTGGGGTGGG + Intronic
1067644004 10:48078053-48078075 GTCACAGTGGTGTGTGGGGTGGG - Intergenic
1068058446 10:52037872-52037894 GACTCAGCGATGCTTGGGGTTGG + Intronic
1068230874 10:54168357-54168379 GACTCAGCGATGCTTGGGGTTGG - Intronic
1068962313 10:62878479-62878501 GACCCAGTGCTGTCTGGGGAGGG - Intronic
1069889322 10:71643492-71643514 GCCTCAGTGTAGGCTGGGATGGG - Intronic
1070280428 10:75044224-75044246 GACAGGGTGGAGGCTGGGGTAGG + Intronic
1070393186 10:75988979-75989001 GAAGCAGAGGTAGCTGGGGTGGG - Intronic
1070508862 10:77141261-77141283 AACTAAGAGGGGGCTGGGGTTGG - Intronic
1070521712 10:77259636-77259658 GGCTCTGTGGTGGTTGGGGTGGG - Intronic
1071731540 10:88253463-88253485 GACACAGAGGCTGCTGGGGTGGG + Intergenic
1071916111 10:90296621-90296643 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1071961023 10:90809045-90809067 GACTCAGTGATGCTTGGGGTTGG - Intronic
1073107589 10:101041100-101041122 GCTTCAGTGGTGGGTGGGGCAGG + Exonic
1073472687 10:103732865-103732887 GGCACTGTGCTGGCTGGGGTCGG + Intronic
1073683431 10:105728923-105728945 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1074062147 10:109976398-109976420 GACTCAGTAGAGATTGGGGTGGG - Intergenic
1074377047 10:112949760-112949782 GAGAAAGTGGTGGCTGGGGGAGG - Intergenic
1074740674 10:116482248-116482270 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1074782075 10:116809246-116809268 GCCTCAGTGGTGGCTTGTGCTGG - Intergenic
1075004589 10:118820760-118820782 GATTCAGATGTGGCTGGGCTAGG - Intergenic
1076619523 10:131778400-131778422 GACTCAGAGATGACTGGGTTGGG - Intergenic
1077143360 11:1034529-1034551 AACTCAGTGGTTCCTGGGATGGG + Intronic
1077154525 11:1085434-1085456 GGCTGAGGGGTGCCTGGGGTGGG + Intergenic
1077675063 11:4187827-4187849 GCCTGAGCGGGGGCTGGGGTGGG + Intergenic
1077850891 11:6073947-6073969 GACTCAGAGATGCTTGGGGTTGG + Intergenic
1077883251 11:6367383-6367405 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1077885271 11:6382767-6382789 GAAGCAGTGGAGGCTGGGGTGGG - Intergenic
1079784495 11:24654632-24654654 TACTCAGGGGTGGGTGGGGTGGG - Intronic
1080274876 11:30492770-30492792 GACTGAGGGGTGGCAGGGGTTGG - Intronic
1081655959 11:44857713-44857735 GGCTGAGTGGTGGATGGGGCTGG - Intronic
1081810826 11:45913344-45913366 GACTGAGTGGGGGCTGGGCCAGG + Intronic
1083658537 11:64241692-64241714 GTCTCCGTGGTGGCCGGGCTTGG + Intronic
1083696357 11:64445361-64445383 GAGTCACTGGTGGGTGGGATTGG + Intergenic
1083929743 11:65834122-65834144 GAGTGAGGGGAGGCTGGGGTGGG - Intronic
1084471776 11:69365814-69365836 GTCTCAGGGGTGGCAGAGGTGGG + Intronic
1085046437 11:73356382-73356404 GACACAGATGTGGGTGGGGTGGG - Intronic
1085118210 11:73949201-73949223 GGGTCTGTGGTGGGTGGGGTGGG + Intergenic
1085348624 11:75784049-75784071 GAATCAGTGGTGTTGGGGGTGGG + Intronic
1085473131 11:76770937-76770959 GACTTAGAGCTGGCTAGGGTGGG + Intergenic
1085735568 11:79036139-79036161 GAGTCAGTGGGGTCTGGAGTGGG + Intronic
1085934166 11:81123417-81123439 GACTCAGTGATGCTTAGGGTTGG - Intergenic
1086434320 11:86766223-86766245 CACTCAGTGGGTTCTGGGGTTGG - Intergenic
1087127717 11:94643205-94643227 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1087196816 11:95311148-95311170 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1087434833 11:98101641-98101663 GACTCAGTGGATGCATGGGTAGG + Intergenic
1088817993 11:113434472-113434494 GTCACAGTGGTAGCTGGGGTTGG + Intronic
1088818164 11:113435321-113435343 GACTCAGTGTGGGGGGGGGTGGG + Intronic
1089032257 11:115344548-115344570 GCCTCAGTGGAGGGTGAGGTAGG - Intronic
1089288051 11:117420222-117420244 GCCGCAGTGGTGGCTGGTGGTGG + Intergenic
1089489205 11:118871375-118871397 GAGCCAGTGGAGGGTGGGGTGGG - Intergenic
1089741336 11:120586621-120586643 GACTCAGCGGTGCTTGGGATGGG + Intronic
1089867154 11:121642069-121642091 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1089953157 11:122548163-122548185 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1090223990 11:125057740-125057762 GACACCTTGGTGGTTGGGGTGGG + Intergenic
1090405053 11:126471475-126471497 GGGTCAGTTGGGGCTGGGGTGGG + Intronic
1091323919 11:134670079-134670101 GACTCAGTGGTTGCAGGGCTTGG + Intergenic
1091404635 12:201610-201632 GCCTCAGTGATGTGTGGGGTTGG + Intronic
1092592845 12:9967189-9967211 GACTCAGCGATGCTTGGGGTTGG + Intronic
1092723813 12:11466280-11466302 GACTCAGTGACGCTTGGGGTTGG + Intronic
1093268105 12:17025793-17025815 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1093322078 12:17724395-17724417 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1094104922 12:26801044-26801066 GACTGAGTGGGCACTGGGGTTGG + Intronic
1095634879 12:44421313-44421335 GAGTCAGGGGTGGCTTGTGTTGG - Intergenic
1096599642 12:52720480-52720502 GACTGTGTGGTGTCTGGGCTTGG - Intergenic
1096635904 12:52959285-52959307 GACTCAGCAGTTGGTGGGGTAGG + Intergenic
1096873267 12:54608143-54608165 GACTCTGTGGTGGCTTTGCTGGG - Intergenic
1097284779 12:57868967-57868989 GACTGGGTGGTGGCTGGTGTCGG + Intergenic
1097398489 12:59103456-59103478 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1097542292 12:60956105-60956127 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1098166098 12:67699568-67699590 GTCTCAGTGGTGGCAGTGGGTGG - Intergenic
1098628965 12:72704952-72704974 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1098630132 12:72713014-72713036 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1099292196 12:80787187-80787209 GACTCAGTGATGCTTTGGGTTGG + Intergenic
1099836199 12:87911519-87911541 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1099872643 12:88368906-88368928 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1102037943 12:109782869-109782891 GCCTGAGAGGTGGCTGAGGTTGG - Intergenic
1102625055 12:114228191-114228213 CAGTCAGTGGTGGCAGGGCTGGG + Intergenic
1103962589 12:124618190-124618212 GAGGCAGGGCTGGCTGGGGTTGG + Intergenic
1106313150 13:28571444-28571466 GACTCAGAGGAGGCTGGGGTGGG - Intergenic
1107769881 13:43778422-43778444 GAATGAGTGGTAGCTGGGGGTGG - Intronic
1108202600 13:48057981-48058003 GACTCAGCGATGCTTGGGGTTGG - Intronic
1108473527 13:50790671-50790693 GACAACGTGCTGGCTGGGGTAGG + Intronic
1108803973 13:54131811-54131833 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1108919644 13:55659084-55659106 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1109343484 13:61089928-61089950 GACTCAGTGACGCTTGGGGTGGG - Intergenic
1110326424 13:74221294-74221316 GACTAAGTGATGGCTGGGCGCGG - Intergenic
1111458938 13:88516918-88516940 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1112491003 13:99863821-99863843 CCCTCTGTGGGGGCTGGGGTGGG - Intronic
1112889419 13:104212181-104212203 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1113324240 13:109266961-109266983 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1113567362 13:111326993-111327015 GGCTCAGAGGGGCCTGGGGTGGG - Intronic
1115679537 14:35720821-35720843 GGCTCAGGGGAGGCTGAGGTAGG + Intronic
1115695750 14:35897416-35897438 GCCTCAGTGGTGGCAGCAGTGGG + Intronic
1116534875 14:46016513-46016535 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1116613412 14:47105775-47105797 GACTCAGCGATGCTTGGGGTTGG - Intronic
1116702503 14:48259505-48259527 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1117083572 14:52176846-52176868 AACTCAGTTGTGGCAAGGGTAGG + Intergenic
1117235712 14:53772434-53772456 GCCTAAGTGGTGGTGGGGGTGGG + Intergenic
1117872262 14:60213500-60213522 GACTCAGTGATGGCTTAGTTAGG - Intergenic
1117958018 14:61137553-61137575 GACTCAGTAATGCTTGGGGTTGG + Intergenic
1119022327 14:71125896-71125918 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1119266160 14:73264345-73264367 AACGCACTGGTGGATGGGGTGGG - Intronic
1121562907 14:94887669-94887691 GGCTCAGTGGGAGCTGGGGGAGG + Intergenic
1121703551 14:95974547-95974569 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1121793279 14:96714913-96714935 GTCTCAGGGGTGGCAGAGGTGGG - Intergenic
1122632296 14:103112538-103112560 AACCCAGCGGTGGCTGGGGCTGG + Intergenic
1122879511 14:104683842-104683864 GACTCAGAAGAGGCAGGGGTGGG - Intergenic
1123405624 15:20018130-20018152 GGCCCCGTGGTGGCAGGGGTGGG - Intergenic
1123514954 15:21024778-21024800 GGCCCCGTGGTGGCAGGGGTGGG - Intergenic
1123882588 15:24689660-24689682 GACCCAGTGATGCTTGGGGTTGG + Intergenic
1124700178 15:31905613-31905635 GACCTAGGGGTGGCTGGGGTTGG - Intergenic
1124710237 15:32003728-32003750 CACTGGGTGGTGGGTGGGGTGGG - Intergenic
1125030074 15:35067271-35067293 AACCCACTGGTGGCTGGGGGAGG + Intergenic
1125045679 15:35240387-35240409 GACTCAGTGATGCTTGGGGTTGG - Intronic
1127488473 15:59440260-59440282 GAATCATTGGGGGCTGGGGCAGG + Intronic
1127781361 15:62319551-62319573 GACTGAGTGGTGTCTGGGTCTGG - Intergenic
1128701508 15:69807891-69807913 CACTCAGTGGCTGCTGGGCTTGG - Intergenic
1128740868 15:70082870-70082892 GACTCTGGGGTTGCTGGGGTTGG + Intronic
1129153228 15:73702281-73702303 GACCCAGTGGTGGCACTGGTGGG + Exonic
1129183910 15:73894243-73894265 GACTCAGTGTGGGCTGCGGGAGG - Intergenic
1130021820 15:80238176-80238198 GACTGAGTGGTGGGTGAGTTTGG - Intergenic
1130090418 15:80816260-80816282 CACTCAGTGGTGGCTGAGGCAGG + Intronic
1130272342 15:82458585-82458607 GACTGAGTGGTGGCCTGGGGAGG + Intergenic
1130464693 15:84185938-84185960 GACTGAGTGGTGGCCTGGGGAGG + Intergenic
1130487992 15:84408866-84408888 GACTGAGTGGTGGCCTGGGGAGG - Intergenic
1130499573 15:84487599-84487621 GACTGAGTGGTGGCCTGGGGAGG - Intergenic
1130586985 15:85190552-85190574 GACTGAGTGGTGGCCTGGGGAGG + Intergenic
1130947577 15:88560584-88560606 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1131350976 15:91699374-91699396 GGCGCAGTTGTAGCTGGGGTTGG + Intergenic
1132253128 15:100349711-100349733 GTCTCAGGGGAGGCTGTGGTGGG - Intergenic
1132340308 15:101074143-101074165 GACTCAGCGATGCTTGGGGTTGG - Intronic
1132819279 16:1854961-1854983 GATGCAGTGGTGGCAGAGGTGGG - Intronic
1133028299 16:2998046-2998068 GTCTCAGTGGGGGAAGGGGTGGG + Intergenic
1133111406 16:3550226-3550248 TAGACAGTGGGGGCTGGGGTAGG - Intronic
1133599235 16:7322958-7322980 GACTCAGTGGTGGGTGGTGTAGG + Intronic
1134110020 16:11509406-11509428 TACTCAGTGTTGGCTGGGCATGG - Intronic
1135387054 16:22051769-22051791 GACTGACTGGTGTCTGGGATGGG + Intronic
1135424922 16:22327647-22327669 AACACAGAGGTGGCTGGGATCGG - Intronic
1135862266 16:26067506-26067528 GGCACAGGGGTGGCTGGGGTGGG - Intronic
1136136962 16:28262098-28262120 GAGCCAGTGCTGGCTGGGGAGGG + Intergenic
1136180527 16:28548765-28548787 GGCCCAGGGGTGGGTGGGGTGGG - Intergenic
1137055489 16:35744425-35744447 GACTCAGCAGTGCTTGGGGTTGG + Intergenic
1137444261 16:48522266-48522288 GAAGCAGTGCAGGCTGGGGTTGG + Intergenic
1137581799 16:49638087-49638109 GACACTGTGGTTGCTGGAGTCGG + Exonic
1137766586 16:50982100-50982122 GAATCAGGGGTTGCTGGGGATGG - Intergenic
1138759204 16:59521743-59521765 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1139039329 16:62983262-62983284 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1139477206 16:67208666-67208688 GACTGAGAGGTGGGTGAGGTAGG + Intronic
1139943814 16:70624877-70624899 GACTCAGTGACGCTTGGGGTTGG + Intronic
1139970319 16:70770230-70770252 GACTCACTGATGGGTGGGATGGG - Intronic
1140049528 16:71467953-71467975 GACTCAGTGGGGGGGGGGGGGGG + Intronic
1140246578 16:73255370-73255392 CACCCAGTGCTGGCTGGGGATGG - Intergenic
1140283171 16:73574346-73574368 GATTCAGTGGATGCTGGGGGGGG - Intergenic
1140465050 16:75174828-75174850 GACACTATGGTGCCTGGGGTTGG - Intergenic
1141236735 16:82225311-82225333 GAATGAGTGGTGGTTGTGGTAGG + Intergenic
1141724823 16:85780920-85780942 GATTCAGTGGGGTCTGGGGTGGG + Intronic
1141759502 16:86018556-86018578 ATCCCAGTGGTGGGTGGGGTGGG + Intergenic
1141808352 16:86357279-86357301 GGCTCAGGGGTGGCTGGAGCGGG - Intergenic
1142582348 17:949833-949855 GGAGCAGTGGGGGCTGGGGTGGG + Intronic
1142699364 17:1649834-1649856 GTCCCAGTGGAGGGTGGGGTGGG - Exonic
1142715563 17:1745258-1745280 GTCTCACTGGTGGCTTGGGCAGG + Intronic
1142809886 17:2390716-2390738 GCCTCACTGGTGGGTGGGGTTGG - Intronic
1143034350 17:3985931-3985953 GTGGCAGTGGAGGCTGGGGTAGG - Intergenic
1143320430 17:6065041-6065063 GACACAGGGGTGTCAGGGGTGGG - Intronic
1143390913 17:6558743-6558765 GACTAAGTGGTGGGAGGGGAAGG - Intergenic
1143622652 17:8089714-8089736 GACACAGATGTGGCTGGAGTTGG + Intergenic
1144660443 17:17064565-17064587 GATTCCTGGGTGGCTGGGGTTGG - Intronic
1144739311 17:17572378-17572400 GACGGAGAGGTGGCTGGGGACGG - Intronic
1146056765 17:29585227-29585249 GACCCAGTGGTGTTTGGAGTGGG - Intronic
1147978700 17:44261981-44262003 GTCTCAGAGGTGGCAGGGGAGGG - Intronic
1148473936 17:47914725-47914747 GACTCTGTGGTGGCTGGAGGGGG + Intronic
1151236791 17:72726155-72726177 GACTGAGTGCTGCCTGGGGCAGG + Intronic
1151839856 17:76610046-76610068 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1152342018 17:79730718-79730740 GACCCAGGTGAGGCTGGGGTGGG - Intergenic
1152580050 17:81161897-81161919 GCCCCAGAGCTGGCTGGGGTGGG - Intronic
1153197863 18:2620772-2620794 AACTCACTGGTGGCTGGGCGCGG + Intergenic
1153863047 18:9233791-9233813 GCCCCAGTGGTGGCAGTGGTGGG + Intronic
1154177595 18:12094854-12094876 GAGTGAGGGTTGGCTGGGGTGGG + Intronic
1154324156 18:13377814-13377836 GACTCTGTGTTGTCTGGGATGGG - Intronic
1155441244 18:25864902-25864924 GAAACACTGGGGGCTGGGGTGGG - Intergenic
1155488872 18:26378127-26378149 GATTCAGTGAAGGGTGGGGTGGG + Intronic
1155941446 18:31805379-31805401 GACTCAGTGGCGCTTGGGGTTGG - Intergenic
1156237256 18:35217358-35217380 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1156302149 18:35845473-35845495 GACTCAGTGATGCTTGGTGTTGG - Intergenic
1156913029 18:42433864-42433886 GGGACAGTGGTGGCTGGAGTTGG + Intergenic
1156915710 18:42463121-42463143 GACACAGTGATGCTTGGGGTTGG - Intergenic
1156938427 18:42738224-42738246 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1157598645 18:48879153-48879175 GAGGCAGGGGTGGCGGGGGTGGG - Intergenic
1157860120 18:51133700-51133722 GCCTCTGTGGGGGCAGGGGTTGG + Intergenic
1158336282 18:56417210-56417232 GACTGAGTGATGCTTGGGGTTGG - Intergenic
1158513675 18:58113537-58113559 GACACTGTGGTGGCTGGAGGGGG + Intronic
1158704764 18:59782336-59782358 GTCTCAGGGGTGGCAGAGGTGGG - Intergenic
1159002652 18:62987702-62987724 GACTCAGTGGGGACTGAGGCTGG - Intergenic
1159068739 18:63598434-63598456 AACTCAGTGGTGCCTAGGATTGG - Exonic
1159164367 18:64683234-64683256 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1159682439 18:71371574-71371596 AAATTAGTGGTTGCTGGGGTTGG + Intergenic
1159834952 18:73326252-73326274 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1159947708 18:74456776-74456798 GGCTCAGGGGTGGCGAGGGTAGG + Intronic
1161316269 19:3619014-3619036 GACACGGGTGTGGCTGGGGTGGG + Intronic
1161325283 19:3660737-3660759 GACTCCGTCCTGGCTGGCGTTGG - Intronic
1161452994 19:4357100-4357122 GACTCAGTGGCGGTGGGGGCAGG + Intronic
1161731090 19:5961039-5961061 GGCTGAATGGTGGCAGGGGTGGG - Intronic
1161853297 19:6750112-6750134 GAGTCACTGCTGGGTGGGGTGGG + Intronic
1162028212 19:7906018-7906040 GACGCAGAGGAGGCTGGGCTGGG - Intronic
1162600504 19:11664922-11664944 AGCTCAGTGATGCCTGGGGTAGG - Intergenic
1162787135 19:13042722-13042744 GCCTCAGTGGGGGTGGGGGTGGG - Intronic
1162967427 19:14162534-14162556 GACCCAGGGGTGGGTGGGGGTGG + Intronic
1163298714 19:16429748-16429770 GAGTCTGTGGAGGCTGGGTTGGG - Intronic
1163497574 19:17655653-17655675 ATCTTAGTGGTTGCTGGGGTCGG - Intronic
1163609797 19:18294936-18294958 GACTGAGTGGTGTCTGGTGGAGG - Intergenic
1163823390 19:19509158-19509180 ATCTCAGTGGGGGCTGGGTTTGG + Intergenic
1163900378 19:20095108-20095130 GACTCAGCGATGCTTGGGGTTGG + Intronic
1163906935 19:20156180-20156202 GAATCAGTGATGCTTGGGGTTGG - Intergenic
1163944553 19:20523189-20523211 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1164532254 19:29057497-29057519 GGGTAAGTGTTGGCTGGGGTGGG - Intergenic
1164940913 19:32251840-32251862 GGCAGAATGGTGGCTGGGGTTGG - Intergenic
1165162632 19:33826743-33826765 GTCGCAGGGGTGCCTGGGGTAGG + Intergenic
1165239614 19:34455373-34455395 ACCTTAGTGGTGGGTGGGGTAGG + Intronic
1165484791 19:36089119-36089141 GCCTCCTTGGGGGCTGGGGTGGG + Intronic
1166231185 19:41426624-41426646 GGCTCAGGGTTGGCTGGCGTGGG + Exonic
1166270067 19:41708214-41708236 CACTGGGTGGTGGCTGGGGAGGG - Intronic
1166337044 19:42114570-42114592 GAGTCTCTGGTGGCCGGGGTGGG + Intronic
1166394304 19:42427461-42427483 AACGGAGTGGTGGGTGGGGTGGG - Intergenic
1166915956 19:46196301-46196323 GCCTCGGTGGTGGCTGAGATGGG - Intergenic
1166925085 19:46261488-46261510 GCCTCGGTGGTGGCTGAGATGGG + Intergenic
1167049198 19:47068347-47068369 GACTCAGTTCTGGCTGGGCCTGG + Intronic
1167765460 19:51479473-51479495 GACTCAGTGGTGACTGAGACAGG + Intronic
1167902049 19:52629374-52629396 GACTCAGCGATGCTTGGGGTTGG - Intronic
1168109920 19:54186593-54186615 AGCTCAGTGGTGGCAGGAGTAGG - Intronic
1168212217 19:54899020-54899042 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1168228889 19:55016027-55016049 TACTCAGTGGAGGCTGAGGCAGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
926407678 2:12571377-12571399 GACTCAGCGATGCTTGGGGTTGG - Intergenic
927135895 2:20096388-20096410 GAGTCAGTGGTTGATGGGGGTGG + Intergenic
927853274 2:26513121-26513143 GAGTCAGTGGGCGGTGGGGTTGG + Intronic
928483762 2:31708856-31708878 AACACAGTGGAGGCTGGGGCAGG + Intergenic
928827751 2:35441201-35441223 GACTCAGAGATGCTTGGGGTTGG + Intergenic
929236974 2:39615823-39615845 GACACAGTGGGGGATGTGGTTGG + Intergenic
929332238 2:40695982-40696004 AAGTCATTGGTGGCTGGGTTTGG + Intergenic
929913463 2:46113865-46113887 GTCTCAGTCCTGGCTGTGGTGGG + Intronic
930099224 2:47590165-47590187 GACTCAGCGATGCTTGGGGTTGG + Intergenic
930656655 2:54013865-54013887 AACTCAGTGGAGGCTGGGTGTGG + Intronic
930958281 2:57230464-57230486 GACTCAGTGATGCTTGGGGTTGG - Intergenic
931166651 2:59756168-59756190 GACTCAGCTTTGGCTAGGGTGGG - Intergenic
931948161 2:67333196-67333218 GACTCAGCGATGCTTGGGGTTGG - Intergenic
932295758 2:70622238-70622260 GACTCAGCGATGCTTGGGGTTGG - Intronic
932325290 2:70855461-70855483 GACACTGTGGAGGCTGAGGTGGG + Intergenic
932442779 2:71748362-71748384 GAGTCAGCAGTGGCTGGGGAAGG + Intergenic
932618457 2:73251229-73251251 GATTCAGTGGTGGCTGGTGGCGG + Exonic
932965628 2:76471707-76471729 TACTCAGTAGGGGCTGAGGTGGG + Intergenic
933054216 2:77642242-77642264 GCCTCAGTGGTGGCAGTTGTGGG + Intergenic
933163634 2:79052991-79053013 GACTCAGTGATGCTTGGGGTTGG - Intergenic
933179860 2:79215936-79215958 GACTCAGTGACGCTTGGGGTTGG + Intronic
933902868 2:86861905-86861927 GAGACAGTCGCGGCTGGGGTGGG + Exonic
933937645 2:87219228-87219250 GAGTCAGAGGTGGCTGGGCTGGG + Intergenic
934669861 2:96204441-96204463 TACTCAGTGGAGGCTGAGGCAGG + Intronic
934775070 2:96932174-96932196 GCCTCTGTGTGGGCTGGGGTGGG - Intronic
934947533 2:98552699-98552721 GGGTCAATTGTGGCTGGGGTTGG + Intronic
935242526 2:101190862-101190884 GGCTCAGTGGGGGCTGGGGCGGG - Intronic
935777677 2:106487365-106487387 GAGACAGTCGCGGCTGGGGTGGG - Intergenic
936029469 2:109059638-109059660 GAGGCAGTGGTGGCTGGAGTTGG - Intergenic
936355494 2:111746545-111746567 GAGTCAGAGGTGGCTGGGCTGGG - Intergenic
936883243 2:117280360-117280382 GACTCAGCGATGCTTGGGGTTGG - Intergenic
937098881 2:119253713-119253735 GAGTGAGTGTTGGCTGGGCTAGG + Intronic
937833711 2:126449998-126450020 TTCTCAGTGGTGGCTGGTGATGG + Intergenic
938764050 2:134448768-134448790 GACCCTCTGGTGCCTGGGGTGGG - Exonic
939307309 2:140427736-140427758 GACTCAGTGATGCTTGGGGTTGG - Intronic
939884044 2:147661901-147661923 GAATCAGTTGTGACTGTGGTAGG + Intergenic
940336041 2:152528665-152528687 TACTCACTGGTGGTTGGGGGAGG + Intronic
940464724 2:154013701-154013723 GGCGCAGTGCTGGCAGGGGTGGG + Intronic
941340307 2:164297472-164297494 GACTCAGCGATGCTTGGGGTTGG - Intergenic
942096988 2:172543330-172543352 GACTCAGCGATGCTTGGGGTTGG - Intergenic
942551616 2:177125850-177125872 GAGTCAGTGGGGGATCGGGTGGG - Intergenic
943344431 2:186721228-186721250 GACTTAATTGGGGCTGGGGTGGG + Intronic
943413031 2:187564584-187564606 GACTCAGCGATGCTTGGGGTTGG + Intronic
943461292 2:188173322-188173344 GACTCAGTGACGCTTGGGGTTGG + Intergenic
943806551 2:192132039-192132061 GACTCAGTGACGCTTGGGGTTGG - Intronic
943865258 2:192919654-192919676 GACTCAGTGATGCTTGGGGTTGG - Intergenic
943951397 2:194135015-194135037 GACTCAGCGATGCTTGGGGTTGG + Intergenic
944250925 2:197579691-197579713 GACTCAGTGATGCTTGGGGTTGG - Intronic
944360138 2:198844539-198844561 GGTTCAGTGGTGGTTGGGGATGG - Intergenic
944387347 2:199180976-199180998 GACTCAGCGATGCTTGGGGTTGG - Intergenic
944394036 2:199248530-199248552 GACTCAGCGATGCTTGGGGTTGG - Intergenic
944876221 2:203966016-203966038 GACTCAGTGACGCTTGGGGTTGG + Intergenic
945173353 2:207018826-207018848 GACTCAGTGACGCTTGGGGTTGG - Intergenic
945361548 2:208900839-208900861 GACTCAGTGACGCTTGGGGTTGG - Intergenic
946397007 2:219448271-219448293 CGCTCAGTGGCGTCTGGGGTCGG - Exonic
946871867 2:224091981-224092003 GACTCAGTGACGCTTGGGGTTGG + Intergenic
948175706 2:235940943-235940965 GTCCAAGTGGTGGCAGGGGTGGG + Intronic
948390585 2:237608561-237608583 GACTCAGTGACGCTTGGGGTTGG - Intergenic
948777215 2:240296050-240296072 GCCACTGTGGGGGCTGGGGTGGG - Intergenic
1168943426 20:1732224-1732246 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1168948493 20:1780723-1780745 GACTCAGTGATGGGCGGGATGGG + Intergenic
1168977698 20:1980510-1980532 AGCTCAGAGGTGGCTGGGGAGGG - Exonic
1169030849 20:2405777-2405799 GACACAGTGGAGGTTAGGGTTGG - Intronic
1170068960 20:12344369-12344391 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1170106136 20:12755489-12755511 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1170169049 20:13391280-13391302 CACTCAGAGGAGGCTGGGGCTGG + Intronic
1171053879 20:21887151-21887173 GACTGAGGGTTGGCTGGGTTTGG + Intergenic
1171425006 20:25043561-25043583 GACTCTGAGGTAGGTGGGGTTGG + Intronic
1171571003 20:26251620-26251642 GTCGCAGTGGCGGCTGGAGTGGG + Intergenic
1171972070 20:31570769-31570791 GCCTCAGAGTTGGCTGGAGTGGG - Exonic
1172383560 20:34516561-34516583 GAATCGGTGGTGGCTGGGCGTGG + Intronic
1172512287 20:35509081-35509103 GAGTTTCTGGTGGCTGGGGTTGG - Intronic
1172813929 20:37671516-37671538 GACCCAGAGGAGGCTGGGCTTGG + Intergenic
1172885840 20:38230161-38230183 GTCTGAATGGTGGCAGGGGTAGG + Intronic
1173828009 20:46059317-46059339 GCGTCAGGTGTGGCTGGGGTAGG + Intronic
1174105713 20:48161029-48161051 CCCTCAGTGGGGGCAGGGGTAGG - Intergenic
1174183833 20:48691488-48691510 TACCCAGTGCTGGCTGGGATGGG + Intronic
1175093055 20:56520465-56520487 GAATCAGTGGCGGCTGGGGCAGG + Intronic
1175441941 20:58998432-58998454 TACTCAGTGGAGGCTGAGGCAGG + Intronic
1175632573 20:60554608-60554630 TTCGCAGTGGTGGCTGGGTTAGG + Intergenic
1175855337 20:62118077-62118099 GGCTCAGGAATGGCTGGGGTGGG - Intergenic
1175920116 20:62446701-62446723 GGCTCAGTGATAGATGGGGTGGG - Intergenic
1175936338 20:62515819-62515841 GGCTCAGAGGTGCCTGGGGATGG + Intergenic
1176118679 20:63444522-63444544 GAGTCAGTGGTGGCTCTGGCTGG - Intronic
1176849398 21:13901273-13901295 GACTGGGTGGTGGGTAGGGTTGG - Intergenic
1177840839 21:26232153-26232175 GACTCAGTGACACCTGGGGTTGG + Intergenic
1178834855 21:36088155-36088177 TATTTATTGGTGGCTGGGGTGGG - Intergenic
1179015388 21:37591137-37591159 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1179387454 21:40956554-40956576 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1180136451 21:45865531-45865553 TACTCAGTGGCGGATGGGGCGGG - Intronic
1180573177 22:16748633-16748655 GTCGCAGTGGCGGCTGGAGTGGG + Intergenic
1181417309 22:22770039-22770061 GACTCAGGGGTGGCTTTGATTGG - Intronic
1183003258 22:34879320-34879342 GACTCAGTCTTGGGTGGGGTGGG - Intergenic
1183053899 22:35289166-35289188 AACGCAGTGGTGGCTGGGCACGG + Intronic
1183307602 22:37090996-37091018 GACTCACTGGTGTGTGGGGTAGG - Intronic
1183410228 22:37650640-37650662 GCCGGGGTGGTGGCTGGGGTGGG - Exonic
1183539242 22:38419977-38419999 GAATCTGTGGTGGGTGGGGCCGG + Intergenic
1184561084 22:45263269-45263291 GTCTCAGTGGTGGCAGTGGCAGG - Intergenic
1185051175 22:48555110-48555132 GAGACAGTGGTGGGTGGGGCAGG - Intronic
949190486 3:1243885-1243907 GACTCAGCGATGCTTGGGGTTGG + Intronic
949525417 3:4898524-4898546 CAGTCAGTGGTGGCTGAAGTAGG - Intergenic
949710375 3:6863723-6863745 GAACCACTGGGGGCTGGGGTAGG + Intronic
949827341 3:8178622-8178644 AACTCAGTGATGCTTGGGGTTGG - Intergenic
950008198 3:9704673-9704695 GACTCAGGGGCGGGTGGAGTCGG + Intronic
950089898 3:10288116-10288138 GACACAGTGCTGGCTGGTGGGGG + Intronic
950397981 3:12748837-12748859 GACTGGGTGGTCCCTGGGGTGGG - Intronic
950500124 3:13358465-13358487 GAGTCAGAGGGAGCTGGGGTGGG - Intronic
951762903 3:26164502-26164524 GACTCAGTGATGCTTGGGGTTGG + Intergenic
951987712 3:28639297-28639319 GTCTCAGGGGTGGCAGAGGTGGG + Intergenic
952386946 3:32848759-32848781 GACCCAGTGGAGTCTGGGGATGG + Intronic
952896154 3:38080369-38080391 GACTCAATGATGCTTGGGGTTGG + Intronic
953077231 3:39581906-39581928 GACTCAGTGACACCTGGGGTTGG + Intergenic
953177092 3:40562587-40562609 GACTCAGTGACGCTTGGGGTTGG - Intronic
953189306 3:40668892-40668914 GCCTTTGTGGTGGCTGGTGTGGG - Intergenic
953251237 3:41247202-41247224 TAGTGAGTGGTGGCTGGGGCTGG - Intronic
953825801 3:46250384-46250406 GACTCAGCGATGCTTGGGGTTGG + Intronic
954129087 3:48550648-48550670 CACTGAGTGATGGATGGGGTGGG - Intronic
954195553 3:48994726-48994748 GAATCAGTGTGGGGTGGGGTAGG - Intronic
954277048 3:49549168-49549190 GAACCACTGTTGGCTGGGGTAGG + Intergenic
954426835 3:50447792-50447814 GGCTCTGTGGTGACTGGGGCAGG - Intronic
954482242 3:50811140-50811162 TCCTCAGTGGAGGCTGAGGTAGG + Intronic
954608852 3:51933720-51933742 GACTTCCTGGTGGCTGGGGTAGG - Exonic
954648353 3:52144871-52144893 GTGTCAGGGGTGGGTGGGGTCGG + Intronic
954789519 3:53121350-53121372 AAATCAGTGGGGGGTGGGGTGGG - Intronic
954969364 3:54638589-54638611 GACTCAGTGACGCTTGGGGTTGG + Intronic
956233603 3:67042837-67042859 GACTCAGCGATGCTTGGGGTTGG + Intergenic
956549086 3:70438982-70439004 GACTCAGGGATGCTTGGGGTTGG + Intergenic
956841233 3:73142106-73142128 GACTCAGTGGTGGGGGGGATTGG + Intergenic
957025219 3:75173871-75173893 GTCTCATTGATGGGTGGGGTGGG + Intergenic
957059992 3:75474150-75474172 GACTCAGTGATGCTTGGGGTTGG + Intergenic
957295142 3:78325483-78325505 GACTCAGCGATGCTTGGGGTTGG - Intergenic
957317408 3:78587253-78587275 GACTCAGCGATGCTTGGGGTTGG + Intergenic
957979933 3:87495644-87495666 GTCTCAGGGGTGGCAGAGGTGGG + Intergenic
958181917 3:90071773-90071795 GACTCAGTGATGCTTGGGGTTGG + Intergenic
958421852 3:93939353-93939375 GACTCAGTGACGCTTGGGGTTGG - Intronic
958676922 3:97277087-97277109 GACTCAGTGACGCTTGGGGTTGG + Intronic
958750902 3:98192550-98192572 GACTCAGTGATGCTTGGGGTTGG - Intronic
959226553 3:103595593-103595615 GTTACAGTGTTGGCTGGGGTGGG - Intergenic
960207240 3:114917931-114917953 GACACAGATGTGGCTGGTGTTGG - Intronic
961036644 3:123647136-123647158 GGGGCAGAGGTGGCTGGGGTAGG + Intronic
961208724 3:125108827-125108849 GAATCACTGGTGGCTGGAGGAGG + Intronic
961293407 3:125865295-125865317 GACTCAGTGACGCTTGGGGTTGG - Intergenic
961450832 3:127001617-127001639 GACTGGGTGGAGGCTGGGGCAGG - Intronic
961603982 3:128079979-128080001 GGCTCCGTGGTGCCTGAGGTGGG - Intronic
961649473 3:128410273-128410295 GACTCTGAGGGGGCTGGGGAGGG - Intergenic
961730486 3:128961332-128961354 GAGTCAGTGATGCTTGGGGTTGG - Intronic
962022284 3:131513230-131513252 GACTCAGTGATGCTTGGGGTTGG + Intergenic
962493042 3:135911933-135911955 GGCTCCATGGTGGCTGGGGTAGG - Intergenic
962586546 3:136847826-136847848 GATTTGGTGGTGGCTGTGGTGGG + Intronic
962805136 3:138921716-138921738 AACTCAGTAGTGGCTAGGGCTGG + Intergenic
963425114 3:145114549-145114571 GACTCAGCGATGCTTGGGGTTGG - Intergenic
963555914 3:146788246-146788268 GAGTGAGTGGTGGCTAGGGATGG + Intergenic
963663237 3:148153254-148153276 GACTCAGCGATGCTTGGGGTTGG - Intergenic
963684230 3:148415951-148415973 GACTCAGCGATGCTTGGGGTTGG - Intergenic
964300347 3:155279301-155279323 GACTCAGCGATGCTTGGGGTTGG + Intergenic
964487823 3:157204156-157204178 GACTACGTGGAGGCTGAGGTGGG - Intergenic
964906610 3:161725962-161725984 GACTCAGTGACGCTTGGGGTTGG + Intergenic
964941064 3:162158287-162158309 GACTCAGAGATGCTTGGGGTTGG + Intergenic
965262757 3:166504919-166504941 GACTCAGTGATGCTTGGGGTTGG + Intergenic
965626418 3:170687459-170687481 GACTCAGTGAAGCTTGGGGTTGG + Intronic
965713302 3:171578019-171578041 GACTCAGTGATGCTTGGGGTTGG - Intergenic
966232945 3:177669938-177669960 GACTCAGTGATGCTTGGGGTTGG + Intergenic
966934457 3:184696806-184696828 GAGTAAGTGGGGGGTGGGGTCGG - Intergenic
967051680 3:185790536-185790558 GATTGGCTGGTGGCTGGGGTTGG - Intronic
967561292 3:190921724-190921746 GACTCAGTGACGCTTGGGGTTGG - Intergenic
967624750 3:191670593-191670615 GACTCAGTGACGCTTGGGGTTGG + Intergenic
967740384 3:192997256-192997278 GACTCAGCAATGCCTGGGGTTGG - Intergenic
968575539 4:1364379-1364401 GGCTCCGTGGGGGCTGGGCTTGG + Intronic
968610479 4:1554626-1554648 GACGCACGGGTGGCTGGGTTTGG - Intergenic
969324189 4:6431515-6431537 GACACAGACGTGGCTGGGGATGG - Intronic
969449893 4:7266962-7266984 GAATCAGTGGGGGGTGGGGGAGG + Intronic
969578218 4:8048716-8048738 GCCTCAGTGGTGGCTACTGTGGG - Intronic
969654212 4:8486956-8486978 GACTCAGTGACGCTTGGGGTTGG + Intronic
970029338 4:11657850-11657872 GACTCAGTGACGGTTGGGGTTGG + Intergenic
970256522 4:14174622-14174644 GACTCAGCGGCGCTTGGGGTTGG + Intergenic
970532623 4:16999273-16999295 GACTCAGTGACGCTTGGGGTTGG - Intergenic
970591892 4:17566885-17566907 GACTCTGTGGTGGTGGGGGTGGG + Intergenic
971200036 4:24502626-24502648 GACTCAGTGACGCTTGGGGTTGG - Intergenic
971738691 4:30492217-30492239 GACTATGAGGTGGCTGGGTTTGG - Intergenic
972558056 4:40200101-40200123 GACAGTGTGGGGGCTGGGGTGGG + Intronic
973073916 4:45899505-45899527 CACTCTGTGTTGCCTGGGGTTGG - Intergenic
974785155 4:66609844-66609866 GTCTCAGTGGTCCCTGGGGAGGG - Intergenic
976117298 4:81741672-81741694 TAATAAGTGGTTGCTGGGGTTGG - Intronic
977041921 4:92027445-92027467 GACTCAGCGATGCTTGGGGTTGG - Intergenic
977326845 4:95584681-95584703 GTGTCAGTGGTGGCAGGAGTGGG + Intergenic
978001216 4:103557858-103557880 GACTCAGCGATGCTTGGGGTTGG + Intergenic
979379835 4:119995522-119995544 GACTCAGTGATGCTTGGGGTTGG - Intergenic
979591365 4:122483916-122483938 TACTCAGTGTGGGCTGGGCTGGG + Intergenic
979850408 4:125565746-125565768 GACTCAGTGATGCTTGGGGTTGG + Intergenic
980003449 4:127515581-127515603 GACTCAGCGATGCTTGGGGTTGG + Intergenic
980284853 4:130768949-130768971 GACTCAGTGATGCTTGGGGTTGG - Intergenic
980388820 4:132119803-132119825 GACTCAGTGATGCTTGGGGTTGG - Intergenic
980903834 4:138929475-138929497 GACTCAGCGATGCTTGGGGTTGG - Intergenic
981016015 4:139975216-139975238 GACTCTGAGGAGGCTGGTGTGGG - Intronic
981809669 4:148759528-148759550 GTCTCAGAGGTGGCAGAGGTGGG + Intergenic
982084060 4:151816697-151816719 GACTCAGTGACGCTTGGGGTTGG + Intergenic
982170460 4:152656364-152656386 GCCCCAGTGGTGACAGGGGTGGG - Intronic
982308614 4:153960341-153960363 GTCTCAGGGGTGGCAGAGGTGGG + Intergenic
982532037 4:156557788-156557810 GGCCCAGTGGTGGCAGTGGTAGG + Intergenic
982784006 4:159522104-159522126 GACTCAATGTGGGCTGGGGAAGG - Intergenic
983163878 4:164451298-164451320 TACTCAGGGGAGGCTGAGGTTGG + Intergenic
983229142 4:165112510-165112532 TTCCCAGTGGAGGCTGGGGTGGG - Intronic
983345459 4:166522110-166522132 GACTCAGTGAAGCTTGGGGTTGG - Intergenic
983447959 4:167877849-167877871 GACTCAGTGACGCTTGGGGTTGG - Intergenic
983707580 4:170679080-170679102 GACTCAGCGATGCTTGGGGTTGG - Intergenic
983931697 4:173460243-173460265 GACTCACTGCTGCCTGGGGTGGG - Intergenic
984165458 4:176298973-176298995 GACTCAGTGATGCTTGGGGTTGG + Intergenic
984293018 4:177819018-177819040 GACCCAGTGGTGGCCGGGCATGG + Intronic
984437163 4:179722032-179722054 GACTCAGTGATGCTTGGGGTTGG - Intergenic
984520495 4:180796104-180796126 CACTCAGTGGTAACTGGGATGGG + Intergenic
984798422 4:183688855-183688877 TACTCAGAGGAGGCTGAGGTGGG - Intronic
986403212 5:7398917-7398939 TAGTCAGCGATGGCTGGGGTAGG + Intronic
987113882 5:14711860-14711882 GACCCAGCAGTGGCTGAGGTGGG - Intronic
987281939 5:16421606-16421628 GACTCAGTGACGCTTGGGGTTGG - Intergenic
987614772 5:20259417-20259439 GCCTCAGGGGTGGCGGAGGTGGG - Intronic
989231099 5:39086880-39086902 GCCCCAGTGGTGGCAGTGGTGGG - Intergenic
989434374 5:41393627-41393649 AACTCACTGGTGGCTGGGCACGG + Intronic
990867372 5:60395167-60395189 AACTCAGTGGTGGAGGGGGGTGG - Intronic
991773237 5:70059481-70059503 GATGCAGAGGTGGGTGGGGTGGG - Intronic
991852530 5:70934905-70934927 GATGCAGAGGTGGGTGGGGTGGG - Intronic
991947832 5:71916685-71916707 GCCTCAGTGGTGGCAGCGGTGGG - Intergenic
992394563 5:76358952-76358974 GACTCAGCGATGCTTGGGGTTGG - Intergenic
992637794 5:78741797-78741819 GAGCCAGGGGTGGCTGAGGTGGG - Intronic
992851097 5:80808507-80808529 CACTTAGTGGTGGATGGTGTCGG + Intronic
993192615 5:84700081-84700103 GACTCAGTGACGCTTGGGGTTGG - Intergenic
993836607 5:92825596-92825618 GACTCAGCGATGCTTGGGGTTGG - Intergenic
994532638 5:100988349-100988371 GACTCAGCGATGCTTGGGGTTGG + Intergenic
994775589 5:104033223-104033245 GACTCAGTGATGCTTGGGGTTGG - Intergenic
995125307 5:108572930-108572952 GACTCAGTGACGCTTGGGGTTGG + Intergenic
997531066 5:134581539-134581561 GCCTCCCTGGTGGCAGGGGTGGG + Exonic
997746301 5:136302903-136302925 GACTCAGTGACGCTTGGGGTTGG - Intronic
997788841 5:136738475-136738497 GACTCAGTGATGCTTAGGGTTGG - Intergenic
998693816 5:144615546-144615568 GACTCAGTGATGCTTGGGGTTGG + Intergenic
999136166 5:149320794-149320816 GATTCCGTGGTGTCTGGGGCAGG + Intronic
999302940 5:150502251-150502273 GAGTCAGTGGTGGGTGGGGACGG + Intronic
999618964 5:153453805-153453827 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1000192431 5:158924472-158924494 CACTCAGCTGTGGCTGGTGTGGG - Intronic
1000438489 5:161241557-161241579 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1000885431 5:166743223-166743245 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1001354621 5:171007515-171007537 GACTCAGCGATGCTTGGGGTTGG + Intronic
1002223241 5:177700510-177700532 AACTCAGTTGTGGCTGGGCGTGG + Intergenic
1004106162 6:12668984-12669006 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1005645377 6:27832986-27833008 TACTCAGGGGAGGCTGAGGTGGG - Intergenic
1006133893 6:31884277-31884299 GATTCAGTGGTGCATGGGGAGGG + Intronic
1006158286 6:32027350-32027372 GACACAGCGGTGGCTGCCGTGGG - Exonic
1006171930 6:32098041-32098063 CACACAGTGGGGGCTGGAGTGGG - Intronic
1006318358 6:33304383-33304405 TGCTCAGTGGTGACTGGGGGCGG + Exonic
1006371431 6:33646370-33646392 GAGGCAGTGGTGGAGGGGGTGGG - Intronic
1006405551 6:33842784-33842806 GGCTCAGTGGTGGCAGGGGCAGG + Intergenic
1006906774 6:37538180-37538202 GACACAGCGGGGGCTGGTGTGGG - Intergenic
1007271231 6:40638818-40638840 GACTCACTGGTAGGTGAGGTGGG - Intergenic
1007747385 6:44051449-44051471 GAGACAGTGGGGCCTGGGGTAGG + Intergenic
1007764937 6:44154716-44154738 GACTCAGAGGTGGACGGGGATGG + Exonic
1008047298 6:46864293-46864315 GACTCAGTGGTGGCAAAGGATGG + Intronic
1008226238 6:48920297-48920319 GACACAGTGGTGCAAGGGGTGGG - Intergenic
1008455625 6:51707560-51707582 GACAGAGTGGTAGCTGGAGTTGG - Intronic
1008476416 6:51939747-51939769 GACTCAGTGATGCTTGGGGTTGG - Intronic
1008975882 6:57426254-57426276 CACTCAGTGGTTGCTTGGGACGG - Intronic
1009164410 6:60323377-60323399 CACTCAGTGGTTGCTTGGGACGG - Intergenic
1009218926 6:60959337-60959359 GCCCAAGTGGTGGCTGTGGTGGG + Intergenic
1010894634 6:81349208-81349230 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1012014491 6:93834188-93834210 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1012015883 6:93850875-93850897 GACTCAGTGGCGACGGGGGTGGG - Intergenic
1013407982 6:109859853-109859875 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1013891605 6:115033499-115033521 GACTGAGTGATGCTTGGGGTTGG - Intergenic
1014555743 6:122841435-122841457 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1014611980 6:123558208-123558230 GACTCAGTGATGCTTGGGGTTGG - Intronic
1014614769 6:123586388-123586410 GACTCAGTGATGCTTGGGGTTGG + Intronic
1014718795 6:124893651-124893673 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1014794093 6:125705972-125705994 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1014891447 6:126850367-126850389 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1015266635 6:131297072-131297094 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1015269562 6:131325034-131325056 GACTCAGTGATGCATGGGGTTGG - Intergenic
1015271274 6:131340489-131340511 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1015323731 6:131903285-131903307 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1015365642 6:132394077-132394099 GCCTCAGTGGTGGCAGCAGTGGG - Intronic
1015982941 6:138857359-138857381 GACTCAGTTAAGTCTGGGGTGGG + Intronic
1016114247 6:140261518-140261540 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1016337359 6:143021692-143021714 GACTCAGTGGTATTCGGGGTGGG - Intergenic
1016853163 6:148641388-148641410 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1017193666 6:151678973-151678995 AACCCAGTGGTGGCTGGGTGTGG - Intronic
1018084604 6:160290681-160290703 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1018370566 6:163164478-163164500 CACTCAGTGGGCGCTGGGGATGG + Intronic
1018521577 6:164656262-164656284 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1018740591 6:166725643-166725665 GAGCCAGTGGGGGGTGGGGTGGG + Intronic
1020541228 7:9462626-9462648 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1021172563 7:17415368-17415390 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1021953086 7:25794924-25794946 GACCCAGTGGTTGCTAAGGTGGG - Intergenic
1022048610 7:26643636-26643658 GTCTCAGTGGCGGCGGGGGGGGG + Intronic
1022372776 7:29786469-29786491 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1022467295 7:30660545-30660567 CCCTCAGCGGTGGCTGGGATGGG - Intronic
1022532710 7:31076846-31076868 CCCTCAGTGGTGGCTGAGGAGGG + Intronic
1023466076 7:40456613-40456635 GAGTCAGTGTTGAGTGGGGTGGG + Intronic
1026163891 7:67893268-67893290 TACTGATTGGTGGCTGGGGATGG - Intergenic
1026496769 7:70910380-70910402 GAGACAGTGGTGGCTTGAGTTGG - Intergenic
1028929661 7:96398367-96398389 GACTGAGTTCTGGCTGGCGTGGG + Intergenic
1029438651 7:100575770-100575792 CACTGAGTTTTGGCTGGGGTGGG + Exonic
1030441788 7:109596151-109596173 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1031083845 7:117282951-117282973 GACTGAGTGGAGACTGGGGGAGG + Intronic
1031399890 7:121317186-121317208 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1031525493 7:122818520-122818542 GACTCAGTGATGCTTGGGGTTGG - Intronic
1031568728 7:123331007-123331029 GTCCCAGTGGTGGCAGTGGTGGG - Intergenic
1031685747 7:124730629-124730651 GACTCAGAGATGCTTGGGGTTGG - Intergenic
1031728029 7:125263013-125263035 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1033428079 7:141263506-141263528 GACAGAGTGAAGGCTGGGGTAGG + Intronic
1034345387 7:150382418-150382440 GGCTCAGTGGTGGGTGGGCTGGG + Intronic
1034593423 7:152163703-152163725 GAATTAGGGGTGGCTGGGGCTGG + Exonic
1034979747 7:155468121-155468143 GTCTCCGTGGAGGCTGGGGGTGG - Intergenic
1035673005 8:1434420-1434442 GACCCAGTGGTGGGTGTGGCAGG - Intergenic
1035786926 8:2268907-2268929 GAAGAAGTGGTGGCTGAGGTTGG - Intergenic
1035805881 8:2452809-2452831 GAAGAAGTGGTGGCTGAGGTTGG + Intergenic
1036472437 8:9063568-9063590 GACTCAGCGATGCTTGGGGTTGG + Intronic
1036900859 8:12668052-12668074 CTCTCAGTGGTGGGTGGGGTGGG - Intergenic
1037287467 8:17316851-17316873 GAATCTATGGGGGCTGGGGTGGG + Intronic
1037354205 8:17999604-17999626 CAGTCAGTGCTGCCTGGGGTTGG + Intronic
1037609463 8:20464117-20464139 GACTCAGTGGTGAGTTTGGTTGG + Intergenic
1037911067 8:22743855-22743877 GACTCCGTGGAGGGTGGGGCTGG + Intronic
1037986583 8:23294213-23294235 GAATGAGCTGTGGCTGGGGTTGG + Intronic
1038196407 8:25372460-25372482 GTCTCAGCAGTGGCTGGGGCAGG - Intronic
1038234790 8:25742153-25742175 CACTCAGAGTTGGCGGGGGTGGG + Intergenic
1038882912 8:31634486-31634508 GAGTCAGTGATTGCTGGTGTGGG - Intergenic
1039792721 8:40888375-40888397 GCCTCAGAGGTGGGTGGGGAAGG - Intronic
1040063000 8:43120604-43120626 TACTCAGGGGAGGCTGAGGTGGG - Intronic
1041415944 8:57609098-57609120 GGTGCTGTGGTGGCTGGGGTTGG - Intergenic
1041957033 8:63567501-63567523 GACTCACTGGTTTCAGGGGTAGG - Intergenic
1042453451 8:68974772-68974794 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1042707261 8:71676512-71676534 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1042906141 8:73773980-73774002 GCCTCAGTGATGGCTGAGGGAGG + Intronic
1043608359 8:82030510-82030532 GAAACAGTGGTTACTGGGGTGGG - Intergenic
1043978219 8:86607730-86607752 GACTGAGTGGTAGCTTGGGCTGG - Intronic
1044416987 8:91949618-91949640 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1044921888 8:97176695-97176717 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1045644686 8:104287558-104287580 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1047074509 8:121385184-121385206 AATTCAGTGGTGACTGAGGTTGG - Intergenic
1047699256 8:127433342-127433364 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1047823006 8:128541969-128541991 GCTTGAGTGGTGACTGGGGTTGG + Intergenic
1048097514 8:131311787-131311809 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1048583132 8:135747131-135747153 GACCCAGTGGTGGCTGAGAAAGG + Intergenic
1048585518 8:135771242-135771264 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1049530017 8:143149376-143149398 GACTCACTGGAGGCTGGGTGTGG + Intergenic
1049688728 8:143949650-143949672 GACTTGGTGGTGGCTGGGGACGG - Intronic
1049733623 8:144191939-144191961 GGCTCAGTGGTGGGTGGGGGTGG + Intronic
1049868921 8:144958403-144958425 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1050117494 9:2277157-2277179 GACTCAGCGACGCCTGGGGTTGG - Intergenic
1050258210 9:3815293-3815315 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1051052522 9:12949920-12949942 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1051508139 9:17847466-17847488 GATCCAGAGGGGGCTGGGGTGGG - Intergenic
1051953502 9:22662644-22662666 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1052162986 9:25289287-25289309 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1052191731 9:25670515-25670537 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1052653226 9:31327979-31328001 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1052720741 9:32168650-32168672 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1053057920 9:35005060-35005082 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1053164918 9:35837489-35837511 GGCTCAGTGTGGGCTGGTGTTGG + Intronic
1054807587 9:69408875-69408897 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1055232960 9:74087264-74087286 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1055347819 9:75355903-75355925 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1055809949 9:80139009-80139031 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1056323782 9:85460246-85460268 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1056479383 9:86985534-86985556 AACACAGTGGTGGCTGTGGGTGG - Intergenic
1056522341 9:87412526-87412548 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1056810188 9:89757921-89757943 GCCTCGTGGGTGGCTGGGGTGGG - Intergenic
1056882877 9:90414175-90414197 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1057484122 9:95468832-95468854 GAGGCAGTGGAGGCTGGAGTCGG + Exonic
1057812685 9:98269956-98269978 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1057981978 9:99671765-99671787 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1058351360 9:104028495-104028517 GACACAGTGGTGGACAGGGTAGG + Intergenic
1058903604 9:109462597-109462619 GGCTCGGTGGTGACTGGGGTGGG + Intronic
1059528008 9:115010687-115010709 GATTCAGTGGTGACTGAGGCTGG + Intergenic
1059606810 9:115843315-115843337 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1060217501 9:121747085-121747107 GCTGCAGTTGTGGCTGGGGTTGG + Intronic
1060226049 9:121791567-121791589 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1060318568 9:122534709-122534731 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1060737981 9:126078750-126078772 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1060960214 9:127675460-127675482 GACTCAATCCTGGCTGGGGGCGG - Intronic
1061204004 9:129152670-129152692 GGCTGAGTGCTGGGTGGGGTGGG - Intergenic
1061283320 9:129609563-129609585 CACTCAGGGCTGGCGGGGGTGGG - Intronic
1061582955 9:131548652-131548674 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1062021592 9:134322085-134322107 GGCTCATTGGAGGCTGGGGGCGG + Intronic
1062713541 9:137990094-137990116 GACTCAGTGCTGTTGGGGGTGGG + Intronic
1186477369 X:9868035-9868057 GACTCAGTGGTGACCGGGTGGGG - Intronic
1186731265 X:12412693-12412715 GACTCAGTGGTTCCTGGGAGAGG + Intronic
1188360490 X:29246839-29246861 GCCTCAGGAGTGGGTGGGGTGGG + Intronic
1188450116 X:30300465-30300487 GACACAATGGTGGCAGTGGTGGG + Intergenic
1188689024 X:33106273-33106295 GACTCAGAAGTGGAGGGGGTGGG + Intronic
1188890944 X:35610663-35610685 GACTCAGTGATGTTTGGGGTTGG - Intergenic
1189707917 X:43778215-43778237 GAGACAGTGGGGGATGGGGTAGG + Intronic
1192174713 X:68878472-68878494 GAGGAACTGGTGGCTGGGGTAGG + Intergenic
1192706032 X:73529229-73529251 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1192795394 X:74421280-74421302 GAGGCAGTGGCGGCTGGAGTAGG + Intergenic
1193953891 X:87835107-87835129 GTCTCAGTTGTGGCAGTGGTGGG + Intergenic
1194186345 X:90777413-90777435 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1194228436 X:91291601-91291623 GACTCAGAAGTGGGTAGGGTGGG - Intergenic
1194308632 X:92277140-92277162 GACTCAGTGACGCTTGGGGTTGG + Intronic
1194503084 X:94702928-94702950 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1195841380 X:109180008-109180030 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1196469754 X:116011905-116011927 GACTCAGTGGCACTTGGGGTTGG - Intergenic
1196533633 X:116816558-116816580 GACTCAGTGACGCTTGGGGTTGG + Intergenic
1196796109 X:119503166-119503188 TACTGAGTGCTGGCTAGGGTGGG + Intergenic
1197354207 X:125416052-125416074 GTCTCAGGGGTGGCAGAGGTGGG - Intergenic
1197793538 X:130278629-130278651 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1197932978 X:131713654-131713676 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1198598351 X:138260386-138260408 GACTCAGTGATGGTTGGGGTTGG - Intergenic
1198599494 X:138268403-138268425 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1198816643 X:140598615-140598637 GTCTCAGGGGTGGCAGAGGTGGG - Intergenic
1198999430 X:142616684-142616706 AATTCAGTGGTGGTTGGGGCGGG + Intergenic
1199157682 X:144569941-144569963 CACTTGGTGGTGGCTGGGGTGGG + Intergenic
1199576381 X:149317277-149317299 GACTCAGTGACGCTTGGGGTTGG - Intergenic
1199772034 X:150981248-150981270 GGCTCAGAGGTGGCTGGAGATGG + Intronic
1199830087 X:151540485-151540507 TACTCAGTGGTGGCTTCTGTGGG - Intergenic
1201936987 Y:19420182-19420204 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1201942696 Y:19476863-19476885 AACTCAGTGTTGGCTGGGCAGGG + Intergenic
1201964424 Y:19716060-19716082 GGCTCAGTGTTGGCTGAGGTGGG - Intronic
1202061951 Y:20897804-20897826 GACTCAGTGATGCTTGGGGTTGG - Intergenic