ID: 907497417

View in Genome Browser
Species Human (GRCh38)
Location 1:54854066-54854088
Sequence GCCCATGAAGTGCCTGCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907497417_907497422 25 Left 907497417 1:54854066-54854088 CCTGCTGCAGGCACTTCATGGGC 0: 1
1: 0
2: 0
3: 19
4: 189
Right 907497422 1:54854114-54854136 GCTGCTCGTACAGCTTGCGCAGG 0: 1
1: 0
2: 2
3: 4
4: 38
907497417_907497419 1 Left 907497417 1:54854066-54854088 CCTGCTGCAGGCACTTCATGGGC 0: 1
1: 0
2: 0
3: 19
4: 189
Right 907497419 1:54854090-54854112 CCAGCATGTCCTGCACCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 132
907497417_907497423 26 Left 907497417 1:54854066-54854088 CCTGCTGCAGGCACTTCATGGGC 0: 1
1: 0
2: 0
3: 19
4: 189
Right 907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907497417 Original CRISPR GCCCATGAAGTGCCTGCAGC AGG (reversed) Exonic
900614311 1:3557717-3557739 GCCCAGGAAGCACCAGCAGCAGG + Intronic
901183266 1:7356252-7356274 CCCCAGGAACTGCCTGCAGAGGG - Intronic
901545829 1:9956261-9956283 GCCCAAGAATTGCCTGAACCTGG - Intronic
904289265 1:29473666-29473688 CCCCAGGAAGGGCCTGCAGATGG - Intergenic
905853276 1:41290107-41290129 GCCCAGGGAGAGCGTGCAGCTGG + Intergenic
905941552 1:41867251-41867273 GGCCATCATGTGCCTACAGCAGG + Intronic
907421865 1:54353098-54353120 GTCCAGGGAGCGCCTGCAGCTGG - Intronic
907492500 1:54817114-54817136 GCTCATGCAGTGAGTGCAGCTGG + Exonic
907497417 1:54854066-54854088 GCCCATGAAGTGCCTGCAGCAGG - Exonic
907580853 1:55571394-55571416 GCCCATGCAGAGCCTGCTGCTGG - Intergenic
912041482 1:105396853-105396875 GCCCATGAAAAGACTTCAGCTGG - Intergenic
912480881 1:109981386-109981408 GCCGAAGAAGTGCCAGCAGCAGG - Intergenic
915244610 1:154547524-154547546 GCCCTTGGGGTGTCTGCAGCAGG + Exonic
922798789 1:228354468-228354490 GTCCTTGAAGAGCCTGGAGCTGG + Intronic
923632103 1:235657430-235657452 GGCTTTGAAATGCCTGCAGCAGG + Intergenic
1063962414 10:11318064-11318086 GGAAATCAAGTGCCTGCAGCTGG + Intronic
1064757777 10:18587668-18587690 ACCCAGGAAGTGCAAGCAGCTGG + Intronic
1068920258 10:62475831-62475853 GCCAATCAGGTGCCGGCAGCTGG + Intronic
1069661734 10:70127586-70127608 CCCCATGAAGGGCCCGGAGCAGG - Intronic
1069958655 10:72067077-72067099 GCCAATGGAGTCCTTGCAGCTGG + Exonic
1070767642 10:79065990-79066012 ACCCAGGAAGTGGCTGCAGAGGG - Intergenic
1071490974 10:86136141-86136163 GCCCATGCAATGCCTCCAGGTGG + Intronic
1074182748 10:111078038-111078060 GCCCATGGGCTCCCTGCAGCCGG + Exonic
1074977738 10:118595079-118595101 GCCCTTCCAGAGCCTGCAGCTGG - Exonic
1077493096 11:2871144-2871166 CCCCATGGGGTGCCTGCTGCAGG - Intergenic
1077722873 11:4645321-4645343 CCCCATTACCTGCCTGCAGCAGG + Intronic
1078351957 11:10602128-10602150 GCCCAGGAAGTCACTCCAGCTGG - Intronic
1078364570 11:10695324-10695346 GTCCCTGTAGTGCCTGCTGCTGG - Intergenic
1078498108 11:11841376-11841398 GCCCCTGAGGTCCCTCCAGCTGG + Intergenic
1078743798 11:14091941-14091963 GCCCAGGAAGTGCAAGCAGCTGG - Intronic
1079191958 11:18286004-18286026 GCCCATGAAAAACCTGCAGGCGG + Intronic
1082913349 11:58402609-58402631 GTCCATGGAGTGACTGGAGCTGG + Exonic
1082914876 11:58422461-58422483 GTCCATGGAGTGGCTGGAGCTGG + Exonic
1084148226 11:67276106-67276128 TCCCGTGAAATGACTGCAGCTGG - Intronic
1084475826 11:69388590-69388612 AGCCATGCAGTGCCTGCAGGTGG + Intergenic
1084657190 11:70526615-70526637 TCCCCTGAAGTGCCTGCTTCCGG + Intronic
1085718840 11:78895980-78896002 GCCCCTGAACTGCCTGTAGGAGG + Intronic
1089303318 11:117511731-117511753 GCCCAAAAAGTGGCTGCAGGTGG - Intronic
1089860725 11:121588023-121588045 GTCCATGAAGTGCGTACAGAGGG - Exonic
1090418097 11:126554832-126554854 GCCCATGAAAAGACTTCAGCTGG + Intronic
1090510467 11:127369407-127369429 GCCCATGGAGTGTCTGCAGAAGG - Intergenic
1090845762 11:130528488-130528510 GCGAGTGAAGTGGCTGCAGCAGG + Intergenic
1090908282 11:131096335-131096357 GGCCATGAGGTGTCTGCAGTTGG + Intergenic
1095734702 12:45543943-45543965 CCCCATGAAGAGCTTGAAGCTGG + Intergenic
1096870881 12:54591330-54591352 GCCCAGGCTGTGACTGCAGCAGG - Intergenic
1102874117 12:116436609-116436631 GCCCATGCCCGGCCTGCAGCAGG + Intergenic
1105817596 13:24051278-24051300 GGACATGCTGTGCCTGCAGCCGG + Intronic
1107560724 13:41554745-41554767 GCCCATGCAGTGCCTTCTCCTGG - Intergenic
1113817599 13:113185034-113185056 GCCCATCACGTGTCAGCAGCTGG - Intronic
1115243344 14:31270615-31270637 CTCCATGCAGTGCTTGCAGCTGG - Intergenic
1116981295 14:51173939-51173961 GCCCAAGCAGTCCCTGCTGCAGG + Intergenic
1117518922 14:56530926-56530948 GCTCTTGCTGTGCCTGCAGCAGG + Intronic
1119715879 14:76859031-76859053 GCACAAGAAGGGCCTGCGGCAGG - Intronic
1122853050 14:104547072-104547094 GCCCATGAGGACCCTGCATCTGG - Intronic
1202845435 14_GL000009v2_random:168688-168710 GCCCATGAAAGGCCTGCATAGGG - Intergenic
1124474752 15:30023146-30023168 CCCCAGGAAGTGCAAGCAGCCGG - Intergenic
1128944555 15:71811832-71811854 GCTGAAGAAGTGCCTGCAGGCGG + Exonic
1130980905 15:88811345-88811367 GCCCAGGTTGAGCCTGCAGCAGG + Intronic
1137633176 16:49962452-49962474 GCAGTTTAAGTGCCTGCAGCTGG + Intergenic
1138575260 16:57903629-57903651 GCCCCTGAAGTGCCTCTAGCAGG - Intronic
1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG + Exonic
1141757318 16:85999978-86000000 ACCCATGATGTGGCTGCGGCTGG - Intergenic
1141850605 16:86642733-86642755 GCCAATAATGTGCCTCCAGCAGG - Intergenic
1142129427 16:88425948-88425970 GCCCAGGGACTGCCTGCACCGGG - Intergenic
1142171115 16:88623358-88623380 GCCCATGAAGGGCCCTCAGCAGG + Intronic
1142355758 16:89601037-89601059 GTCCAGGGACTGCCTGCAGCAGG + Intergenic
1142430469 16:90023489-90023511 CCCCACCAAGTCCCTGCAGCTGG + Intronic
1143478235 17:7215039-7215061 GCCCAAGAGGAGCCTGCAGGGGG - Intronic
1143683204 17:8492859-8492881 GACCAAGAACCGCCTGCAGCAGG - Exonic
1143962916 17:10735374-10735396 GGCCATGAGGTGCTTGCAGTAGG + Intergenic
1144305438 17:13965839-13965861 GCCCATGAAAAGACTTCAGCTGG - Intergenic
1144854237 17:18259070-18259092 GCCCAGGAAGTGCCTGTACTTGG + Intergenic
1144867853 17:18348281-18348303 GCACATGAAGAGGCTGCACCAGG + Intronic
1144945874 17:18969243-18969265 GCCCAGGAAGTGGCCCCAGCAGG + Exonic
1145252556 17:21304531-21304553 GGCCATGTAGGGCTTGCAGCCGG - Exonic
1145324008 17:21783378-21783400 GGCCATGTAGGGCTTGCAGCCGG + Intergenic
1147740866 17:42670286-42670308 GCGCCTGCAGAGCCTGCAGCGGG - Exonic
1148269026 17:46249298-46249320 GCACAAGAAGTGCTTGAAGCTGG + Intergenic
1148819572 17:50352853-50352875 GCACATGTACTGCCTGGAGCTGG - Intronic
1149429268 17:56584072-56584094 GCCCTTAAAGTGCCTGGAGGTGG - Intergenic
1150789085 17:68185731-68185753 GCCCATGCAGGACCTGCAGGGGG + Intergenic
1154939112 18:21093279-21093301 GCAAATGATGTGACTGCAGCTGG - Intronic
1157276396 18:46313849-46313871 GCACATGGGCTGCCTGCAGCCGG - Intergenic
1157422811 18:47560396-47560418 GCCCAGGGAGTGCAAGCAGCAGG + Intergenic
1160954960 19:1686905-1686927 CCCCGTGAACTGCCTGCACCCGG - Intergenic
1163251072 19:16126623-16126645 GGTGGTGAAGTGCCTGCAGCTGG + Intronic
1164156765 19:22601993-22602015 GCCCATGAAGAGCATCCTGCAGG + Intergenic
1165430146 19:35767585-35767607 GCCGAGCAAGTCCCTGCAGCTGG + Intronic
1167297726 19:48661742-48661764 GCCCCTGAAGCGGCTGCAGCAGG - Exonic
1167722334 19:51187160-51187182 GGCCATGTGGTGCCTGCAGATGG - Intergenic
926799855 2:16650705-16650727 GCCCATTACATGCCTGCAACCGG + Intronic
927666350 2:25035635-25035657 GGCCATGAAGTGGATGCAGCTGG + Intergenic
928091058 2:28375388-28375410 GCCCTTGGAGTGGCTGCAGAGGG + Intergenic
928904654 2:36356324-36356346 GACCAGGAGGTGCCCGCAGCCGG - Exonic
931063161 2:58554137-58554159 GTCCATGAAGGACCTGCAGGAGG - Intergenic
931982637 2:67710916-67710938 GCCCAAGAAGGGACTGCAGCAGG + Intergenic
933277932 2:80302958-80302980 GCACCTGCAGTCCCTGCAGCTGG - Exonic
935709187 2:105882073-105882095 GCGCATTTACTGCCTGCAGCCGG - Intronic
937356886 2:121203274-121203296 GCCCTTGGAGTGCCACCAGCTGG - Intergenic
937466275 2:122135673-122135695 GCCCTTTCAGTGCCTGCATCTGG - Intergenic
937539061 2:122926010-122926032 GCCCATGAAAAGACTTCAGCTGG - Intergenic
937644977 2:124256546-124256568 GCTAAGGAAGTTCCTGCAGCTGG + Intronic
938769859 2:134492003-134492025 ACCCATGAAGTGCCAGCAGGTGG - Intronic
939735620 2:145840904-145840926 TCAAATGAAGTGCCTGCATCTGG - Intergenic
939791860 2:146587669-146587691 GTCCGTGAACTTCCTGCAGCCGG + Intergenic
940276649 2:151947152-151947174 AGCCATGAAGTGCCTTCTGCAGG - Intronic
941557825 2:167005331-167005353 GCCAATGAAGTCACTGCAGGTGG + Intronic
942770133 2:179507290-179507312 GCCCATGAATAGGCTGCAGGGGG - Intronic
943369577 2:187001453-187001475 GCCCAGGAAGTGCCAGAGGCAGG + Intergenic
945055598 2:205866357-205866379 GCCCAAGCAGTGCCTGAGGCTGG + Intergenic
946347721 2:219124636-219124658 GCCCAGGAAATGCAGGCAGCTGG - Intronic
948374461 2:237512306-237512328 TGCCTTGAAATGCCTGCAGCAGG - Intronic
948466620 2:238155166-238155188 TCCCATGACGTGCCGGCACCAGG - Intergenic
949083645 2:242127688-242127710 GCCAATGAAGTGCCTTAAACAGG + Intergenic
1169421405 20:5463629-5463651 GCCCAGGAAGTGCAAGGAGCTGG - Intergenic
1174557749 20:51407906-51407928 GCCCATGAAAAGACTGTAGCAGG + Intronic
1176093891 20:63330816-63330838 GCTCAGGAAGAGCCTGCAGGTGG + Exonic
1176280229 20:64300221-64300243 GCCAATGAAGTGCCTTAAACAGG + Intergenic
1179308314 21:40174910-40174932 ACCCATGAAATGGCTGCATCTGG - Intronic
1179889902 21:44330224-44330246 CCCCACGCAGGGCCTGCAGCCGG + Exonic
1180834543 22:18923302-18923324 GCCCATGAAGTCCTTGCACATGG + Intronic
1181065345 22:20303209-20303231 GCCCATGAAGTTCTTGCACATGG - Intergenic
1181138593 22:20787017-20787039 TCCCATGAAGAGCAGGCAGCTGG - Exonic
1182475071 22:30572824-30572846 GCCCTTCAGGAGCCTGCAGCCGG + Intronic
1182972296 22:34589850-34589872 GCCCATGAAGTTCCTGTTGTAGG + Intergenic
1184482990 22:44759021-44759043 GTCCCTGAAGTGGATGCAGCTGG - Intronic
1185246255 22:49774895-49774917 GCCTATGGTGTGCCTGGAGCAGG - Intronic
1203284632 22_KI270734v1_random:148601-148623 GCCCATGAAGTCCTTGCACATGG + Intergenic
950016390 3:9757609-9757631 TCCCATGCAGGGCCGGCAGCTGG - Exonic
950763610 3:15256884-15256906 GCCCTCGAAGTGAATGCAGCGGG - Exonic
954292305 3:49656049-49656071 GCCCAGTATGGGCCTGCAGCAGG + Exonic
956501610 3:69892761-69892783 GACCATGAAGGGCCTACTGCTGG - Intronic
958779292 3:98522589-98522611 GCCCAGGAGGTGGCTGCTGCAGG - Intronic
961373112 3:126444116-126444138 GCCCACGAAGCCCCAGCAGCAGG + Intronic
962456969 3:135573639-135573661 TCCCTTGAACTCCCTGCAGCTGG - Intergenic
962843514 3:139255767-139255789 GCCCAATAAGTGCTTGCAGCTGG + Intronic
964226997 3:154415587-154415609 GCGCATGCAGTACATGCAGCAGG + Intronic
965596714 3:170418476-170418498 GCCCTTGGAGTGCTCGCAGCAGG + Intergenic
968487375 4:870258-870280 GCCCAGGAAGTGCTGGCAGGTGG - Intronic
972681654 4:41312115-41312137 GCCCATAAAAAGACTGCAGCTGG + Intergenic
977666183 4:99649689-99649711 GCCCATGACCTCCCAGCAGCAGG - Exonic
978820564 4:112959807-112959829 GCCCAACAAGTGTCTGGAGCTGG - Intronic
980151734 4:129056046-129056068 ACCCGTGAAGTGCAAGCAGCCGG - Intronic
981855001 4:149278893-149278915 GCCCAAGAATTGCTTGAAGCTGG + Intergenic
983272848 4:165583388-165583410 GCACATGAAGTGGCAGAAGCAGG + Intergenic
985915963 5:2919511-2919533 GCCCCTTTAGTGCCAGCAGCTGG - Intergenic
989243413 5:39225988-39226010 ACCCATGAGAGGCCTGCAGCTGG - Intronic
990801816 5:59612812-59612834 GAACATGAAGTACCTGAAGCAGG + Intronic
991398812 5:66232926-66232948 CCAAATGAAGTGTCTGCAGCTGG + Intergenic
991685142 5:69174888-69174910 GCCCAAGAAGATGCTGCAGCTGG + Exonic
995760680 5:115558219-115558241 ACACATGTATTGCCTGCAGCAGG + Intergenic
995948600 5:117681759-117681781 TCCCAGGGAGTGCCTTCAGCGGG + Intergenic
999328239 5:150656628-150656650 GCGCCAGAAGCGCCTGCAGCTGG - Intronic
999714861 5:154352497-154352519 GCCCATGAAAACCCTGCAGCTGG + Intronic
1002051268 5:176572978-176573000 GTCAAGGAAGTGACTGCAGCGGG + Intronic
1002399972 5:178986280-178986302 GCCCAGGAAGAGCCTGCGGGCGG + Exonic
1002752891 6:135024-135046 GCCAATGAAGTGCCTTAAACAGG - Intergenic
1003975237 6:11336875-11336897 GCCCCTGAAGATCCTCCAGCAGG - Intronic
1004420879 6:15468834-15468856 GCCCATGAAGTGTCTGGCCCTGG - Intronic
1004630397 6:17415666-17415688 GCCCCTGAAAAGCTTGCAGCCGG + Intronic
1005945128 6:30589859-30589881 GCCCACTGAGTACCTGCAGCGGG + Exonic
1007597674 6:43061482-43061504 GACCATTGAGTGTCTGCAGCAGG + Exonic
1008543797 6:52568170-52568192 GCCAATGGAGGGCCTGCAGCAGG - Intronic
1010462148 6:76125834-76125856 TCCCTTGAAGTGCCTGCTTCTGG + Intergenic
1013083088 6:106829902-106829924 TCCCATGAAGTGCCTGTTACTGG + Intergenic
1013191393 6:107806855-107806877 GCCCACATGGTGCCTGCAGCTGG + Intronic
1013370728 6:109468737-109468759 TCCCATGAAGTTCATTCAGCAGG - Intronic
1016382891 6:143503261-143503283 GCCCAGGAAGTGCAAGCAGAAGG + Intronic
1017108008 6:150906373-150906395 GCCCAAGCAGTGCCCGCAACAGG + Intronic
1017161013 6:151366128-151366150 GCCATGGAAGTGCCTGAAGCCGG - Exonic
1017286938 6:152686299-152686321 GCCCATGAAAAGACTTCAGCTGG - Intergenic
1022490992 7:30817602-30817624 GGCCAAGAAGTGCTTGCAGGTGG + Intronic
1026463269 7:70632869-70632891 GCCTGTGAACTGCCTGCAGGAGG - Intronic
1026772874 7:73213267-73213289 GCCCATGTCGTGCCTGGAGCTGG + Intergenic
1026898788 7:74026016-74026038 GCCCAGGATGTGCCTGCTGCAGG - Intergenic
1027013737 7:74766663-74766685 GCCCATGTCGTGCCTGGAGCTGG + Intergenic
1027074301 7:75179369-75179391 GCCCATGTCGTGCCTGGAGCTGG - Intergenic
1029055076 7:97732953-97732975 GCCCAGGAACTCCCTGCAGTAGG + Intronic
1029976037 7:104834730-104834752 GCCCATGCAGGTCCTGCAGGCGG + Intronic
1032539081 7:132688364-132688386 GGCCATCAAGTGGCTGCAGAAGG - Intronic
1034268296 7:149791563-149791585 GCCCATGGGGGCCCTGCAGCCGG + Intergenic
1035936379 8:3845946-3845968 GCCCCTGAGGAGCCTGCAGTGGG - Intronic
1036183902 8:6607952-6607974 GCCCAAGAAGTGGGTGGAGCTGG + Intronic
1036713749 8:11100906-11100928 GCCCATAAAGTGCATGCCCCCGG - Intronic
1036761100 8:11509019-11509041 GGCCATGAGCTGCATGCAGCTGG + Intronic
1039792308 8:40885745-40885767 GCCCAAGAAGACCCTGAAGCTGG - Intronic
1040759548 8:50822577-50822599 GCTGATGAATTGCCTGCAGTAGG - Intergenic
1041287229 8:56273420-56273442 GCCCAGGAAGTGCAAGGAGCGGG + Intergenic
1042054645 8:64751002-64751024 TCCCATGAATTTCCTGCTGCAGG + Intronic
1043525756 8:81095052-81095074 GTCCATGAACTCCCTGCATCAGG + Intronic
1046932495 8:119855627-119855649 GCCCACGCTGTGCCAGCAGCTGG - Exonic
1049001320 8:139827168-139827190 GCCCGGGAAGCGCCTACAGCAGG + Intronic
1049172186 8:141168419-141168441 GCCCAAGAAGCACATGCAGCTGG + Exonic
1049355364 8:142185229-142185251 GCTGATGAAGCGCCTGCAGTAGG - Intergenic
1049420140 8:142512854-142512876 GCCCCTGAAATTCCAGCAGCAGG + Intronic
1049796255 8:144498543-144498565 CACCATGAAGGGCCTGCAGGTGG + Intronic
1050343838 9:4666564-4666586 GCCCACGCAGTGCCCCCAGCCGG + Exonic
1055464877 9:76554841-76554863 GCCCCTGAAGTCCTTCCAGCGGG - Intergenic
1056379057 9:86040964-86040986 TCAGATGAAGTGCCTGAAGCAGG - Intronic
1058907235 9:109491795-109491817 GCTCTTGCAGTCCCTGCAGCAGG + Intronic
1061991328 9:134160355-134160377 AACGATGAAGTTCCTGCAGCAGG - Intergenic
1062073671 9:134572772-134572794 GCCCAGGACCTGCATGCAGCAGG - Intergenic
1062276664 9:135734546-135734568 GTCCATGGAGTGCCCACAGCCGG - Intronic
1062289759 9:135789258-135789280 GCCCAGGAAATGCCTGCCGCGGG - Intronic
1194480472 X:94415504-94415526 GCCCAAGAAGTCACTGCAACAGG - Intergenic
1195243857 X:102979080-102979102 GCCCATGAAGTCCCAGCTGTGGG + Intergenic
1195689952 X:107616352-107616374 GCCCAAGAAATGCCTGCAGAAGG + Intergenic
1196170314 X:112580082-112580104 GACCATGAAGCCCCTCCAGCTGG + Intergenic
1198310874 X:135425114-135425136 GCCCAGGAAGAGGCTGGAGCTGG - Intergenic