ID: 907497418

View in Genome Browser
Species Human (GRCh38)
Location 1:54854090-54854112
Sequence CCACGTGGTGCAGGACATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907497418_907497428 29 Left 907497418 1:54854090-54854112 CCAGCATGTCCTGCACCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 907497428 1:54854142-54854164 ACCCTGGGTCAGCTTCAGGAGGG 0: 1
1: 0
2: 3
3: 22
4: 215
907497418_907497426 25 Left 907497418 1:54854090-54854112 CCAGCATGTCCTGCACCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 907497426 1:54854138-54854160 TCTCACCCTGGGTCAGCTTCAGG 0: 1
1: 0
2: 2
3: 21
4: 242
907497418_907497424 13 Left 907497418 1:54854090-54854112 CCAGCATGTCCTGCACCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 907497424 1:54854126-54854148 GCTTGCGCAGGGTCTCACCCTGG 0: 1
1: 0
2: 0
3: 11
4: 108
907497418_907497422 1 Left 907497418 1:54854090-54854112 CCAGCATGTCCTGCACCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 907497422 1:54854114-54854136 GCTGCTCGTACAGCTTGCGCAGG 0: 1
1: 0
2: 2
3: 4
4: 38
907497418_907497425 14 Left 907497418 1:54854090-54854112 CCAGCATGTCCTGCACCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 907497425 1:54854127-54854149 CTTGCGCAGGGTCTCACCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 124
907497418_907497423 2 Left 907497418 1:54854090-54854112 CCAGCATGTCCTGCACCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 40
907497418_907497427 28 Left 907497418 1:54854090-54854112 CCAGCATGTCCTGCACCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 907497427 1:54854141-54854163 CACCCTGGGTCAGCTTCAGGAGG 0: 1
1: 0
2: 2
3: 21
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907497418 Original CRISPR CCACGTGGTGCAGGACATGC TGG (reversed) Exonic
900819411 1:4874673-4874695 CCACGTGGTGCAAGACAGAGGGG + Intergenic
901299636 1:8190097-8190119 CCACAGGGTGCAGCACATTCTGG - Intergenic
902825204 1:18968496-18968518 CCACGTGTTGCAGGACCTGGTGG + Intergenic
907315419 1:53567790-53567812 CCACGTGGTGTTGGGCCTGCAGG + Intronic
907497418 1:54854090-54854112 CCACGTGGTGCAGGACATGCTGG - Exonic
909065575 1:70931592-70931614 CCACGTGGTGCTGAGCCTGCAGG - Intronic
909265973 1:73558579-73558601 CCACATGGTGTTGGACCTGCAGG + Intergenic
910761802 1:90740256-90740278 CCTCGTGGAGAAGGAGATGCTGG - Intergenic
911023132 1:93408571-93408593 CCACGTGGTGTTGGGCATGCGGG + Intergenic
912703862 1:111897594-111897616 CCAGGTAGGGCAGGGCATGCAGG + Intronic
914941301 1:152025170-152025192 CCACGTGGCCCAGGCCATGGTGG - Intergenic
917014937 1:170519440-170519462 GCAGGTTGTGCAGGACATGAAGG - Intergenic
919536745 1:198797025-198797047 CCACATGGTGCTGGGCCTGCAGG - Intergenic
920184079 1:204149902-204149924 CTATGTGGAGGAGGACATGCAGG - Exonic
920693742 1:208165814-208165836 CCACGTGGGCCAGGACATCTGGG + Intronic
924692444 1:246364068-246364090 CCAAGGGATGCAGGACAAGCTGG + Intronic
1063367369 10:5499440-5499462 CCGCGAGGTGCAGGAGACGCAGG - Exonic
1069784197 10:70977501-70977523 CCACGTGGGGAAGGAGAAGCAGG + Intergenic
1070590353 10:77796490-77796512 GGACGTGGTGAAGGAGATGCTGG - Exonic
1070642532 10:78180021-78180043 CCCCGTGGTGCAGGAAGGGCTGG + Intergenic
1075048248 10:119163292-119163314 CCACGTGATGGAGGACAGACTGG - Intronic
1075395533 10:122124323-122124345 CCAGGTGATGCAGGACACACTGG - Intronic
1076845642 10:133068298-133068320 CCCCTTGGTGCAGAACATTCTGG - Intergenic
1076873325 10:133204111-133204133 CCCCATGGTGCAGGCCATGGGGG + Intronic
1076915889 10:133423099-133423121 CCACTGGGTGCAGGAGCTGCTGG - Exonic
1076939264 10:133590754-133590776 CCCCGTGGAGCAGAAGATGCAGG - Intergenic
1077252265 11:1565919-1565941 GCACATGGTGCTGGACCTGCAGG + Exonic
1081727120 11:45338134-45338156 CCACGGGGTACAGGACTTGCTGG + Intergenic
1086073869 11:82829376-82829398 CCACGTGAAGAAGAACATGCTGG + Intronic
1088746075 11:112806101-112806123 CCACCTGCTGCAGCACCTGCTGG - Intergenic
1090842771 11:130507316-130507338 CCACGTGGTGTTGGGCCTGCAGG + Intergenic
1091614338 12:2037586-2037608 CCACTTTGTGCAGGTCAGGCAGG + Intronic
1091713525 12:2760056-2760078 CCACAGGGCACAGGACATGCTGG - Intergenic
1091745018 12:2986182-2986204 TCCAGTGGGGCAGGACATGCAGG - Intronic
1094505258 12:31055829-31055851 CCACCAGGCACAGGACATGCTGG + Intergenic
1095926748 12:47586281-47586303 CCTTATGCTGCAGGACATGCTGG - Intergenic
1096072438 12:48782777-48782799 CTACGTGGTGCTGGGCATCCTGG - Exonic
1097732901 12:63150443-63150465 CCGCGTGGTGAAGCACCTGCAGG - Exonic
1097891476 12:64781219-64781241 CCGCGTGCTGCAGGAGCTGCAGG + Intronic
1099996693 12:89786520-89786542 CCATGTGGTGTTGGACCTGCAGG + Intergenic
1101876621 12:108600302-108600324 CCATGTGGGGCAGGACATGGTGG - Intergenic
1101997933 12:109538430-109538452 CCACGTGGGGCAGGAAGTGGAGG - Intergenic
1105214086 13:18274230-18274252 GCACAGGGTGCAGGACAGGCAGG + Intergenic
1105287582 13:19018511-19018533 CTTCATGGTGCAGGACATGTTGG - Intergenic
1105537937 13:21287507-21287529 CCAGGTGCTGCGGGACCTGCGGG + Intergenic
1110208634 13:72947181-72947203 CCACGTGGTGTTGGGCATGCAGG - Intronic
1111421625 13:88018916-88018938 CCATGTGGTGTTGGACCTGCGGG + Intergenic
1116356448 14:43937023-43937045 CCATGTGGTGTTGGACCTGCAGG - Intergenic
1120234621 14:81876211-81876233 CCATGTGGTGTTGGTCATGCAGG + Intergenic
1122606958 14:102953138-102953160 GGTCGTGGTGCAGGCCATGCGGG + Intronic
1122765511 14:104066759-104066781 CCACGTGGTGTTGGGCATGTGGG - Intergenic
1122799242 14:104221541-104221563 CCACGTGGTGGGTGGCATGCAGG + Intergenic
1122924178 14:104892171-104892193 CTAAGTGGGGCAGGACCTGCTGG + Intronic
1122984946 14:105207714-105207736 CAAGGTGCTGCTGGACATGCTGG + Intergenic
1124017576 15:25890443-25890465 CCACTTGCTGAAGGACATGGTGG + Intergenic
1127527971 15:59812683-59812705 GCGTGTGGTGCAGGCCATGCGGG + Intergenic
1128596918 15:68960757-68960779 CCAAGGGGAGCAGGACATGGAGG - Intronic
1130439158 15:83933862-83933884 CCACGTGGTGTTGGGCCTGCAGG + Intronic
1131158703 15:90090626-90090648 CCACGTGGGGCAGGATGAGCTGG + Exonic
1131383735 15:91985783-91985805 CCACCTTCTGCAGGACAAGCAGG - Intronic
1133045174 16:3083957-3083979 CCACGTGGTGTTGGGCCTGCAGG - Intergenic
1133512488 16:6473107-6473129 CCATGTGTTGCAGGGCATCCTGG - Intronic
1133762300 16:8808816-8808838 ACACGTGGTAGAGGACAGGCTGG + Intronic
1137000421 16:35225083-35225105 CCAGGTGGTGCAGATCAGGCAGG + Intergenic
1137702941 16:50510312-50510334 CCAGGTGGTGCAGGAGCTGCTGG + Intergenic
1142608271 17:1094192-1094214 CCACCTGGTGCAGGCCAGGCAGG + Intronic
1142682163 17:1556511-1556533 CCAGGTGCTCCAGGACAGGCTGG + Intronic
1142758227 17:2028261-2028283 CTCCGTGGTGCAGGACATTGGGG - Intergenic
1142909904 17:3080008-3080030 CCACGTGGTGTTGGGCCTGCAGG - Intergenic
1144872756 17:18380955-18380977 CCAGGTGGAGCGGGACATCCTGG + Exonic
1146452749 17:32987636-32987658 CCACGTGGTGTTGGGCCTGCAGG - Intronic
1149164033 17:53728047-53728069 CCATGTGATGAAGGACATGTTGG - Intergenic
1151328918 17:73395278-73395300 CCACGTGGTGCAGGACCGTGTGG - Exonic
1151748494 17:76024044-76024066 CCAGGTGGAGCGGGACATCCTGG - Exonic
1153932216 18:9887909-9887931 CCACGTGGTGTGGGCCCTGCAGG + Exonic
1156242968 18:35271627-35271649 GCACGCGGTGCAGGACTGGCAGG - Intronic
1158129734 18:54139552-54139574 CCACGTGGTGTTGGGCATGCAGG + Intergenic
1158404710 18:57151112-57151134 CCACGTGGGGAATAACATGCGGG + Intergenic
1160631817 18:80251984-80252006 CCACCTGGGGGTGGACATGCAGG - Intergenic
1160765242 19:804684-804706 TCACCTGGTGCAGCACATCCAGG - Exonic
1160779340 19:870927-870949 GGACCTGGGGCAGGACATGCAGG + Intronic
1162530986 19:11236463-11236485 CAACGTGGAGCAGGAGCTGCGGG - Exonic
1163191957 19:15683553-15683575 CCATGTGCTGGAGGATATGCTGG - Exonic
1163201271 19:15771173-15771195 CCATGTGCTGGAGGATATGCTGG + Intergenic
1163838816 19:19593200-19593222 CCTGGTGGGGCAGGACATGGTGG - Intronic
1164681288 19:30135350-30135372 CCAGATTGTGCAGGACGTGCAGG - Intergenic
1165016193 19:32881875-32881897 CCAGGTGCTGAAGGACAAGCAGG - Exonic
1166526395 19:43513059-43513081 ACACGTGGTGCTGGGCCTGCTGG + Intronic
1168339277 19:55614329-55614351 GCACCTGGTCCAGCACATGCTGG + Exonic
1168642191 19:58037959-58037981 CCACGTGGTACTGGAACTGCCGG - Exonic
926149934 2:10419787-10419809 CGAGGTGCTGCAGGACCTGCGGG + Exonic
926294420 2:11558482-11558504 CAACGTGGAGCTGGACAAGCCGG - Intronic
926375530 2:12223819-12223841 CCACGTGGTGTTGGGCCTGCAGG + Intergenic
927719532 2:25373758-25373780 CCACCTGGTTGAGGACTTGCTGG + Intergenic
928749896 2:34459048-34459070 CCACATGGTGTTGGACCTGCAGG + Intergenic
930419664 2:51134996-51135018 CCACGTGGTGTTGGTCCTGCAGG + Intergenic
934300233 2:91772520-91772542 GCACAGGGTGCAGGACAGGCAGG - Intergenic
936263956 2:110985775-110985797 CCACGTGGTAAAATACATGCAGG - Intronic
936788790 2:116125610-116125632 CCATGTGGTGTTGGACCTGCAGG - Intergenic
937325822 2:120989106-120989128 CGACGTGGTGCAGTACATCAAGG + Exonic
939663909 2:144926059-144926081 CCACGTGGTGGAAGACATCGTGG + Intergenic
942880731 2:180857774-180857796 CCACGTGGTGTTGAGCATGCAGG - Intergenic
948134760 2:235628291-235628313 CCACTTGGTGGAGGAGCTGCTGG + Intronic
948468614 2:238163849-238163871 CGACGTGGTGGGGGACGTGCTGG + Exonic
1171180401 20:23087057-23087079 CCTCGTGGCGCAGGGCTTGCAGG + Intergenic
1171200372 20:23235818-23235840 CCACTTGGAGCAGGCCATCCTGG + Intergenic
1171423101 20:25032146-25032168 CAACGTGGTGGACGACATGGGGG - Intronic
1173730495 20:45325163-45325185 CTACGGGGTGCCAGACATGCCGG - Intergenic
1176089020 20:63310791-63310813 CCACGTGCTGGAGGCCAAGCAGG - Intronic
1177139693 21:17344706-17344728 CCACGTGGTGTTGAGCATGCAGG + Intergenic
1177803230 21:25848666-25848688 CCACGTGGTGCTGGGCCTGCAGG + Intergenic
1179243488 21:39611468-39611490 CTTCTTGGTGCAGGACGTGCTGG + Intronic
1180840188 22:18955452-18955474 CCCCGTGGGGCAGGACAGGGTGG - Intergenic
1181020705 22:20100726-20100748 CCAGGTGGAGAAGGACATGGGGG + Intronic
1181555783 22:23671001-23671023 ACACAGGGTGCAGGACAGGCAGG + Intergenic
1181698593 22:24607650-24607672 GCACAGGGTGCAGGACAGGCAGG - Intronic
1181727646 22:24822600-24822622 CCAGGTGGTGCTGGGCATGCAGG + Intronic
1182477475 22:30584004-30584026 CCACATGGTGCTGGGCATGCAGG + Intronic
1183282311 22:36938244-36938266 CCACTTGCTGCAGGACAAGGAGG - Exonic
1183359148 22:37374395-37374417 CCGCGTGGTGAAGGTCAGGCAGG + Exonic
1184810358 22:46827274-46827296 TCACGTGGGGCAAGTCATGCAGG + Intronic
1184850266 22:47115768-47115790 CCGCGTGGGTCATGACATGCTGG - Intronic
1184968577 22:47998888-47998910 CCCTGGGGTGCAGGACAGGCAGG - Intergenic
1184978334 22:48078963-48078985 TCTCGTGGTGCAGGAAATGGAGG + Intergenic
1185059243 22:48597470-48597492 CCAGGTGATGCAGGCCATGGTGG - Intronic
1185132725 22:49048867-49048889 CCACGCGGGTGAGGACATGCTGG + Intergenic
1185350085 22:50330867-50330889 CCAAGGGATGCAGGACAAGCTGG + Intergenic
949192259 3:1264419-1264441 ACAGGTGGTTCAGGACATGTTGG - Intronic
954670780 3:52290354-52290376 CCAAGCGGGGCAGGACCTGCAGG - Exonic
955005177 3:54961911-54961933 CCATGTGGTGAGGGACTTGCTGG + Intronic
956214488 3:66834187-66834209 CCACTTGGTGAAGGACATCTGGG + Intergenic
956751993 3:72350915-72350937 CCACCTCTTCCAGGACATGCGGG - Intergenic
958469388 3:94498604-94498626 CCACGTGGTGTTGGGCCTGCAGG + Intergenic
959785693 3:110294929-110294951 CCATGTGGTGTTGGACCTGCAGG - Intergenic
964267937 3:154921336-154921358 CCACATGGTGCTGGACCTGCAGG - Intergenic
965112735 3:164448512-164448534 CCACTTGGTGTTGGACCTGCAGG + Intergenic
965301563 3:167011453-167011475 CCACATGGTGTTGGACCTGCAGG - Intergenic
966452576 3:180078619-180078641 CCACGTGGTGCTGGGCCTGCAGG - Intergenic
968625651 4:1625597-1625619 CCACGTGGGTCGGGACATGGGGG - Intronic
968703097 4:2065970-2065992 CCAGTTGGTGCGGGGCATGCTGG + Exonic
968932757 4:3590705-3590727 CCACGTGGTTTAGGAGAAGCTGG - Intronic
971224415 4:24737838-24737860 CCATGTGGTGTTGGACCTGCAGG + Intergenic
973684275 4:53354057-53354079 GCACGTGGTGCAGGACTGGTGGG - Intronic
973691211 4:53434612-53434634 CCAGGTGTGGCAGTACATGCTGG - Intronic
974608457 4:64183975-64183997 CCACATGATGTTGGACATGCAGG - Intergenic
977883666 4:102234725-102234747 GCACGTGGTGCAGGACTGGTGGG + Intergenic
978587945 4:110293284-110293306 CCAGGTGGTGGAGGAGATGAGGG + Intergenic
980654071 4:135759434-135759456 CCACGTGGTGTTGGCCCTGCAGG - Intergenic
980654605 4:135766018-135766040 CCACGTGGTGTTGGTCCTGCAGG - Intergenic
981503104 4:145473499-145473521 CCACGTGGTGTTGGGCCTGCAGG - Intergenic
981713114 4:147728320-147728342 CCAGGTGGTGGAGGATAGGCAGG - Intergenic
985716219 5:1463404-1463426 CCACGGGGTCCAGGCCAGGCGGG + Exonic
986582332 5:9278782-9278804 CTACGTGGTGCTGGGCCTGCAGG + Intronic
987318282 5:16744579-16744601 GCCCTTGGTGCAGGACATGAAGG + Intronic
987545913 5:19309941-19309963 CCACGTGGTGCTGAGCCTGCAGG - Intergenic
988149962 5:27364660-27364682 CCACATGGTGAAGAACCTGCGGG + Intergenic
988310330 5:29548618-29548640 CCATGTGGTGTTGGACCTGCTGG - Intergenic
991136245 5:63185732-63185754 CCATGTGGTGTTGGACCTGCAGG + Intergenic
992062416 5:73067358-73067380 CAAGGTGGTGCAGGACATTGGGG - Intronic
992887106 5:81169802-81169824 GCAGGTGGTGCAGGTGATGCAGG - Intronic
992887117 5:81169874-81169896 ACAGGTGGTGCAGGTGATGCAGG - Intronic
992887140 5:81170000-81170022 GCAGGTGGTGCAGGTGATGCAGG - Intronic
992887159 5:81170117-81170139 GCAGGTGGTGCAGGTGATGCTGG - Intronic
992887162 5:81170135-81170157 GCAGGTGGTGCAGGTGATGCAGG - Intronic
994425200 5:99576539-99576561 CCACGTGGTGTTGGGCCTGCAGG + Intergenic
994436139 5:99735694-99735716 CCACGTGGTGTTGGGCCTGCAGG - Intergenic
994786990 5:104178708-104178730 CCACGGGTTGCTGGACATGTTGG + Intergenic
999321775 5:150619668-150619690 CCCGGGGGTGCAGGGCATGCGGG + Intronic
1003512300 6:6791631-6791653 CCTTGTGTTGAAGGACATGCAGG - Intergenic
1006693252 6:35908882-35908904 CCACGTGGTGTTGGGCCTGCAGG + Intronic
1011955944 6:93025621-93025643 TCACGTGGTGTAGGGCCTGCAGG - Intergenic
1012131361 6:95497329-95497351 GCACATGGTGCAGGACTGGCGGG + Intergenic
1012700528 6:102451425-102451447 CCACGTGGTGCTGAGCCTGCGGG - Intergenic
1012883294 6:104816474-104816496 CCACGTGGTGTTGGGCCTGCAGG + Intronic
1013490117 6:110638192-110638214 GTACTTGGTGCAAGACATGCAGG + Intronic
1018716082 6:166533614-166533636 ACACCTGGTGCAGGACAAACCGG + Intronic
1020869302 7:13607630-13607652 CCACGTGGTGTTGAGCATGCAGG + Intergenic
1027667467 7:81057456-81057478 GCACATGGTGCAGGACTGGCAGG - Intergenic
1028327680 7:89546918-89546940 ACATGTGGTGCAAAACATGCAGG - Intergenic
1031545741 7:123049870-123049892 CCACGTGGTGTTGCACCTGCGGG - Intergenic
1032786275 7:135202948-135202970 CCACGTGGGCCAGGGCCTGCAGG + Intronic
1033170956 7:139083828-139083850 CGACGTGGTCCAGAACATCCAGG - Exonic
1038534460 8:28343980-28344002 CCAGGTGGTGCAGATCCTGCTGG + Intergenic
1039657280 8:39423496-39423518 CCATGTGGTGCTGAGCATGCAGG - Intergenic
1040670205 8:49680567-49680589 TCACGTGGTGGAGGACAGGAGGG - Intergenic
1045189234 8:99866633-99866655 CCACCTGCTCCAGCACATGCAGG - Intronic
1046257675 8:111722198-111722220 CCACGTGGTGTTGGGCCTGCAGG - Intergenic
1046359449 8:113131482-113131504 CCACGTGGTACTGGGCCTGCAGG + Intronic
1046521328 8:115330540-115330562 GCACGTGGTGCAGGACTGACAGG - Intergenic
1048573232 8:135671901-135671923 CAAAGTGCTGCAGGACATGGAGG - Intergenic
1049197875 8:141325445-141325467 CCACGTGGTGCCTGCCATGCTGG + Intergenic
1050940519 9:11451885-11451907 CCATGTGGTGCTGAGCATGCGGG + Intergenic
1051767451 9:20540464-20540486 CCACGTGGTGTTGGACCTGTGGG - Intronic
1052540914 9:29810663-29810685 CAATGTGGTGCAGGGCCTGCAGG + Intergenic
1052821506 9:33141148-33141170 CCAGGTGGTATAGGGCATGCAGG + Intronic
1053306255 9:36986570-36986592 CCACGTCGCGCAGGAAATCCAGG + Intronic
1054457370 9:65441190-65441212 CCACGTGGTTTAGGAGAAGCTGG + Intergenic
1055351496 9:75393544-75393566 CCAGGTGATGCAGGAGATGCTGG + Intergenic
1056719181 9:89058616-89058638 GGACGTGGTGGAGGACATGGTGG + Intronic
1058317054 9:103581313-103581335 CCACATGGTGTAGGCCCTGCAGG - Intergenic
1061411789 9:130425827-130425849 CCAGCTGGTGCAGCACCTGCGGG + Exonic
1192053639 X:67749570-67749592 CCACATGAAGCAGGAAATGCAGG - Intergenic
1193139956 X:78017154-78017176 CCACGTGGTGTTGGGCCTGCAGG - Intronic
1195210089 X:102646183-102646205 CCACGTGGTGTTGAGCATGCAGG - Intergenic
1195822077 X:108956545-108956567 CCACGTGGTGTTGGGCCTGCAGG + Intergenic
1196582550 X:117394047-117394069 CCACGTGGTGTTGGGCCTGCAGG - Intergenic
1197426629 X:126305087-126305109 CCACGTGGTGTTGGGCCTGCAGG + Intergenic
1198297524 X:135301996-135302018 CCACGTGGTGTTGGACCTGTGGG - Intronic
1198987613 X:142473920-142473942 TCAGGAGGTGCAGGAAATGCAGG + Intergenic
1199823215 X:151471419-151471441 CCACGTGGTGTTGGCCCTGCAGG - Intergenic
1200235863 X:154467456-154467478 CCACGTGGTGCTGAAGGTGCGGG + Exonic
1200756327 Y:6993412-6993434 CCAAGATGTGCAGGACATTCAGG + Intronic
1200757477 Y:7003477-7003499 CCAAGTCATGCAGGCCATGCAGG + Intronic