ID: 907497420

View in Genome Browser
Species Human (GRCh38)
Location 1:54854099-54854121
Sequence CGAGCAGCACCACGTGGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907497420_907497425 5 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497425 1:54854127-54854149 CTTGCGCAGGGTCTCACCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 124
907497420_907497422 -8 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497422 1:54854114-54854136 GCTGCTCGTACAGCTTGCGCAGG 0: 1
1: 0
2: 2
3: 4
4: 38
907497420_907497431 29 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497431 1:54854151-54854173 CAGCTTCAGGAGGGAGATCTTGG 0: 1
1: 0
2: 6
3: 28
4: 268
907497420_907497432 30 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497432 1:54854152-54854174 AGCTTCAGGAGGGAGATCTTGGG 0: 1
1: 0
2: 3
3: 15
4: 178
907497420_907497424 4 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497424 1:54854126-54854148 GCTTGCGCAGGGTCTCACCCTGG 0: 1
1: 0
2: 0
3: 11
4: 108
907497420_907497426 16 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497426 1:54854138-54854160 TCTCACCCTGGGTCAGCTTCAGG 0: 1
1: 0
2: 2
3: 21
4: 242
907497420_907497427 19 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497427 1:54854141-54854163 CACCCTGGGTCAGCTTCAGGAGG 0: 1
1: 0
2: 2
3: 21
4: 177
907497420_907497428 20 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497428 1:54854142-54854164 ACCCTGGGTCAGCTTCAGGAGGG 0: 1
1: 0
2: 3
3: 22
4: 215
907497420_907497423 -7 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907497420 Original CRISPR CGAGCAGCACCACGTGGTGC AGG (reversed) Exonic
901441503 1:9281080-9281102 CCCGCAGCACCACTTGGTGGGGG + Intergenic
904810712 1:33161717-33161739 AGGGCAGCTCCAGGTGGTGCAGG - Intronic
905207797 1:36352865-36352887 CGACTAGCACCACCTGGTGCTGG - Intronic
905648007 1:39638028-39638050 GGCACAGCACCACGTGGTGGTGG - Intronic
906088543 1:43157300-43157322 CGTGCAGCACCTAGGGGTGCAGG - Intergenic
907497420 1:54854099-54854121 CGAGCAGCACCACGTGGTGCAGG - Exonic
910596100 1:88982703-88982725 CGCGGAGCACCAAGAGGTGCTGG - Exonic
918181475 1:182088608-182088630 CCAGCAGCACCCCGTGCTGCTGG + Intergenic
920445344 1:206012184-206012206 AGAGCAGAACAACGTGGGGCGGG + Intronic
920676558 1:208042333-208042355 CGGGCAGCAGCACGTGGAGAAGG - Exonic
922154871 1:223032972-223032994 AGAGCAGCACCAAGGGTTGCTGG - Intergenic
922364297 1:224849712-224849734 AGAGCAGCACCAAGGGCTGCTGG - Intergenic
922738843 1:228004696-228004718 GGAGGAGCCCCACGTGGTACAGG + Intergenic
922792006 1:228316016-228316038 TGAGCAGCAGCAGGTGGCGCAGG - Exonic
924789473 1:247231337-247231359 TGAGGAACACCACGGGGTGCAGG - Intergenic
1063337544 10:5230931-5230953 CGTGAAGCAGCAAGTGGTGCTGG - Intergenic
1065057514 10:21861847-21861869 CGAGCAGCCCCAAGGGCTGCTGG - Intronic
1065801297 10:29355522-29355544 CCAGCAGAACCACTTGGTGGAGG - Intergenic
1066387311 10:34952141-34952163 AGAGCAGCACCAAGGGCTGCTGG - Intergenic
1071495328 10:86163994-86164016 TGAGCAGCACCGGGTGGTGCAGG - Intronic
1084188977 11:67490402-67490424 CGAGGAGTACTACGAGGTGCTGG + Exonic
1085695085 11:78697286-78697308 CAAGCAGCAAGATGTGGTGCAGG + Intronic
1089255709 11:117192816-117192838 CCAGCAGCACCATGCGGTCCTGG - Exonic
1090384347 11:126347964-126347986 CCAGCAGCACCACTGGGGGCTGG - Intergenic
1090446904 11:126772385-126772407 TCAGCGGCACCACGTGGTGCGGG + Intronic
1094709492 12:32947103-32947125 AGAGCAGCCCCACGGGCTGCTGG - Intergenic
1098302071 12:69064465-69064487 GGAGCAGAAGCATGTGGTGCAGG + Intergenic
1103868520 12:124073478-124073500 AGAGCAGCACCAAGGGTTGCTGG + Intronic
1114522194 14:23346824-23346846 CCGCCAGCACCACGTGCTGCAGG + Exonic
1122521648 14:102348356-102348378 TGAGCAGCACCACGTGGGGCTGG + Exonic
1122952232 14:105051347-105051369 CGAGGAGAACCAGGTGGTACGGG + Exonic
1122993812 14:105251662-105251684 AGAGAAGCACCAGGTGGGGCTGG - Intronic
1123940553 15:25214552-25214574 CCTGCAGCACCACCAGGTGCCGG - Intergenic
1124121062 15:26888926-26888948 CAGGCAGAACCACGTGGTGCAGG - Intronic
1125726816 15:41872351-41872373 TGAGCAGCAGCGTGTGGTGCAGG - Exonic
1129413009 15:75360157-75360179 TGAGCAGCTCCACGTCGTGCAGG + Exonic
1129744386 15:78007950-78007972 CTTGCAACACCAAGTGGTGCAGG + Intronic
1131271232 15:90948779-90948801 CGAGCAGCACCCCAAGGTGAGGG + Exonic
1134656362 16:15950506-15950528 AGAGGAGCTCCACGTGTTGCAGG - Intronic
1135345504 16:21685398-21685420 CAACAAACACCACGTGGTGCTGG - Intronic
1135424548 16:22325816-22325838 CCAGCAGAACCACGCGTTGCTGG + Exonic
1137648903 16:50101577-50101599 TGAGAATAACCACGTGGTGCCGG - Intronic
1137785443 16:51134356-51134378 CGCGCAGCCCAAGGTGGTGCAGG + Intergenic
1138340500 16:56286037-56286059 GCAGCAGCACCACGTGGGGAAGG + Intronic
1140847241 16:78902416-78902438 CCAGCAGCGCCACGCGGGGCGGG + Intronic
1141403122 16:83768612-83768634 CGAGCAGCCCCAAGGGCTGCTGG + Intronic
1142200142 16:88757269-88757291 AGCGCAGCAGCACCTGGTGCAGG + Intronic
1143587046 17:7855522-7855544 CGAGCAGCGGCACGAGGAGCAGG - Exonic
1143606071 17:7986979-7987001 CGGCCAGCATCACGTGGAGCAGG + Intergenic
1147535097 17:41315636-41315658 CGGGCAGCACCCCATGGTCCGGG + Exonic
1147636727 17:41968487-41968509 CCACCAGCACCACCTGGTACTGG - Exonic
1148542464 17:48491716-48491738 AGAGCAGCCCCAAGTGCTGCTGG + Intergenic
1148929990 17:51120431-51120453 CCAGGAGCACCAGGTGGAGCTGG - Exonic
1150069522 17:62139438-62139460 GAAGCAGCTCCACGTGGAGCTGG - Intergenic
1151494414 17:74450857-74450879 CCAGCAGCACCTCTGGGTGCCGG + Intronic
1151585047 17:75003747-75003769 CGAGCAGTACCACGCGCTGCTGG + Exonic
1152273829 17:79342098-79342120 CGAGCTGCACCACGAGGTGAGGG - Intronic
1152362075 17:79837427-79837449 AGAGCTGCACCGCGAGGTGCTGG + Intronic
1152490991 17:80633568-80633590 CGGGCTGCACCAGGTGATGCGGG + Intronic
1153627799 18:7038378-7038400 GGAACAGCGGCACGTGGTGCAGG - Intronic
1160969181 19:1759882-1759904 CGCGCAGCCCCACGTGGGTCTGG - Intronic
1164443611 19:28298940-28298962 CAACCAGCTCCACGTGTTGCTGG + Intergenic
1166077710 19:40423336-40423358 CGACCAGCACCAGGTGCCGCAGG + Exonic
1166458125 19:42961391-42961413 CGAGGAGCACCACCTGTTCCTGG - Intronic
1166475066 19:43116643-43116665 CGAGGAGCACCACCTGTTCCTGG - Intronic
1166779419 19:45333147-45333169 ATTGCAGCACCACGTGGTGAGGG - Intergenic
1167577243 19:50323647-50323669 CGCGCAGCCCCACGAAGTGCCGG + Exonic
1167593249 19:50415561-50415583 CAAGCAGGCCCACGTGGAGCTGG + Exonic
925609541 2:5692103-5692125 CGCGCGGCACCACGGGGAGCGGG - Intergenic
928251333 2:29683790-29683812 AGAGCAGCACCACTTGCTTCAGG + Intronic
931012237 2:57930008-57930030 TGAGCTGCACCACCTGGGGCTGG + Intronic
933721749 2:85401582-85401604 TGTGCAGCACCGCGAGGTGCAGG - Exonic
936258711 2:110938392-110938414 TCAGCTGCACCATGTGGTGCTGG - Intronic
936525916 2:113241619-113241641 CGAGCGGCTCGAGGTGGTGCTGG + Exonic
937160945 2:119760205-119760227 CCAGCAGCATGAGGTGGTGCTGG + Exonic
938866757 2:135430027-135430049 CGTGCAACACCACGTGGGCCTGG - Intronic
943524503 2:188999485-188999507 CCAGCAGCACCAGGTGGCCCAGG - Exonic
947674097 2:231961789-231961811 CGTGCAGCACTAGGCGGTGCAGG - Intronic
947984127 2:234434914-234434936 AGAGCAGCACCAAGGGCTGCTGG - Intergenic
948591999 2:239056376-239056398 CCTGGAGCACCTCGTGGTGCTGG + Intronic
948594869 2:239073434-239073456 AGGGCAGCATCACGTGGTCCTGG - Intronic
948607827 2:239147131-239147153 TGAGCAGCAGCACGTGGACCAGG + Intronic
1174284138 20:49460324-49460346 AGAGCGTCAGCACGTGGTGCTGG - Intronic
1175801120 20:61801544-61801566 CGTGTAGCCCCACATGGTGCTGG + Intronic
1179924352 21:44525855-44525877 CAAGCAGAACCACGTGGTCCCGG - Intronic
1181310024 22:21939651-21939673 AGAGCAGCAGCAAGTGGTGGCGG + Exonic
1182368366 22:29793582-29793604 CGAGCAGTACAGCGTGGTGGTGG - Exonic
1183981726 22:41544395-41544417 CGAGCGGCGGCACGTGGCGCGGG - Exonic
1184190436 22:42891096-42891118 CGAGCTGCACCTCGAGGTGAAGG - Exonic
1184563018 22:45274284-45274306 GGAGCAGCATGGCGTGGTGCAGG - Intergenic
1184759274 22:46535769-46535791 CGAGCAGAACTACGTGGTCCAGG - Exonic
1184958628 22:47912109-47912131 TGAGCAAGACCACGTGGTCCTGG + Intergenic
1185258334 22:49848761-49848783 CGAGCAGCTCCACGCGGGCCCGG + Intergenic
951942394 3:28093959-28093981 AGAGCAGCACCAAGGGTTGCTGG - Intergenic
954151681 3:48660975-48660997 CGAGAAGCGCTACGTGGCGCAGG - Exonic
961329739 3:126131497-126131519 GGAGCAGCACCAGGAGGAGCTGG - Exonic
962412938 3:135157183-135157205 CCAGCACCACCACCTGCTGCAGG - Intronic
966855720 3:184192829-184192851 CCAGCTGCTCCACATGGTGCTGG - Exonic
968901413 4:3433666-3433688 GGTGGAGCACCACGTGGCGCAGG - Intronic
975658818 4:76668077-76668099 CAAGCAGCACCAGGAGCTGCAGG - Intronic
976643226 4:87361409-87361431 AGAGCAGCCCCAAGGGGTGCTGG - Intronic
979099508 4:116598283-116598305 CGATCTGCTCCACGCGGTGCTGG - Intergenic
982986758 4:162218782-162218804 CTAGCAGTACAAGGTGGTGCAGG - Intergenic
985855451 5:2421218-2421240 CCAGATTCACCACGTGGTGCTGG - Intergenic
989368567 5:40681668-40681690 CGAGCAGCACCACGCGGCCGCGG + Exonic
994777899 5:104058911-104058933 AGAGCAGCACCAAGGGCTGCTGG + Intergenic
997523472 5:134538031-134538053 CCAGCAGCACCAAGTCGGGCTGG + Exonic
998403988 5:141863345-141863367 CAAGAAGCACCAGGTGGTACAGG - Exonic
1001288237 5:170438849-170438871 CGAGCGGCACACTGTGGTGCTGG + Intronic
1002636662 5:180612086-180612108 GGAGGAGCACCACGTGGGGAGGG + Intronic
1006068041 6:31476663-31476685 CAAGCAGAAGCAGGTGGTGCAGG - Intergenic
1006167523 6:32073770-32073792 CGGGCAGCCCCAGGTGGTGCCGG - Intronic
1018308939 6:162488710-162488732 CGAGCAGGCCCACATGGTGTTGG + Intronic
1019777725 7:2922485-2922507 CTGGCAGCATCACGAGGTGCAGG - Intronic
1022465462 7:30650205-30650227 CTGGCAGCACCTCGTGGAGCTGG - Intergenic
1022672789 7:32471861-32471883 CCAGCGGCACCACCTGATGCCGG - Intergenic
1026119461 7:67524258-67524280 AGAGCAGCCCCAAGTGCTGCTGG + Intergenic
1028795597 7:94898434-94898456 CAATCAGAACCACATGGTGCTGG - Intergenic
1034902308 7:154915149-154915171 CGACCACCACCGTGTGGTGCTGG - Intergenic
1035200942 7:157265571-157265593 CGCGCGGCACGACGTGTTGCTGG - Intronic
1035477941 7:159156952-159156974 AGAGCCGCACCTCTTGGTGCAGG + Intergenic
1048772253 8:137907425-137907447 CGAAGAGGACCACGTGGTGATGG - Intergenic
1049482968 8:142835430-142835452 CGAGCAGCAGAACGTGGAACAGG - Intronic
1049796369 8:144499032-144499054 TGAGCAGCTCCACCAGGTGCAGG - Exonic
1057996456 9:99824493-99824515 CGAGCAGCTCCAGCTGGGGCTGG + Intronic
1186760389 X:12716727-12716749 CGAGGAGGACCTCGTGGTGGGGG + Exonic
1193070787 X:77303608-77303630 GCAGCAGCACCACGTGGGACAGG - Intergenic
1196762014 X:119208824-119208846 CGTGCAGCCCCACGTCCTGCTGG + Intergenic
1197796658 X:130305479-130305501 CGGGCAGCAGCAGCTGGTGCTGG - Intergenic