ID: 907497423

View in Genome Browser
Species Human (GRCh38)
Location 1:54854115-54854137
Sequence CTGCTCGTACAGCTTGCGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907497417_907497423 26 Left 907497417 1:54854066-54854088 CCTGCTGCAGGCACTTCATGGGC 0: 1
1: 0
2: 0
3: 19
4: 189
Right 907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 40
907497418_907497423 2 Left 907497418 1:54854090-54854112 CCAGCATGTCCTGCACCACGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 40
907497420_907497423 -7 Left 907497420 1:54854099-54854121 CCTGCACCACGTGGTGCTGCTCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907497423 Original CRISPR CTGCTCGTACAGCTTGCGCA GGG Exonic
902950962 1:19882572-19882594 CCGCTCGTCCCGCTTGCGCTCGG - Exonic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907718511 1:56950311-56950333 CTGCTCTTACAGCCTCCTCATGG - Intronic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
1063370948 10:5522976-5522998 CTGCACACACAGCTTGCTCAAGG - Intergenic
1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG + Intergenic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG + Exonic
1089783340 11:120890284-120890306 CAGCTCATACAGCTTATGCATGG + Intronic
1102183722 12:110932043-110932065 CTGCTCGTAGAGTTTGAGGATGG + Intergenic
1107408111 13:40134132-40134154 CTGTTTGTACAGCTTGCCCCTGG + Intergenic
1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG + Intronic
1137028584 16:35501573-35501595 CTGCTCCTGCAGCCTGCACAGGG - Intergenic
1141689106 16:85586599-85586621 CTGCTCCTACAACGTGCTCACGG + Intergenic
1144892425 17:18501563-18501585 CAGCTGGTACAGTTTGCGCATGG - Intergenic
1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG + Intergenic
1145796071 17:27655953-27655975 CAGCTGGTACAGTTTGCACATGG - Intergenic
1145810521 17:27761272-27761294 CAGCTGGTACAGTTTGCGCATGG - Intronic
1147945372 17:44077560-44077582 CTGCTGGCACAGCCTGGGCAAGG - Exonic
1149981968 17:61317965-61317987 CTGCCAGAACAGCTTGCGTATGG - Intronic
1150440607 17:65188341-65188363 CTGCTCCAACAGCTTCAGCAAGG + Intronic
1151659547 17:75511691-75511713 CTGAGCCTACAGCCTGCGCAGGG + Intronic
1154328481 18:13409678-13409700 CTTCTCCTCCAGCTTGCGAATGG - Intronic
1159308125 18:66672339-66672361 CTGCTTCTCCAGCTTGCACATGG + Intergenic
1162432332 19:10636522-10636544 CAGGTCGTCCGGCTTGCGCAGGG - Exonic
1167153862 19:47726178-47726200 CAGGTCGTTGAGCTTGCGCAAGG - Exonic
925997926 2:9307051-9307073 CTGCTGGTGCAGCTGGCCCAGGG - Intronic
1181323552 22:22026661-22026683 CTGATCGTACAGTTTAAGCAAGG + Intergenic
1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG + Exonic
1183293724 22:37018232-37018254 CTGCTCGTAGGTCTTGAGCAGGG + Exonic
951728381 3:25783761-25783783 CTGGTCGTACAGGTTGGGAAGGG + Intronic
953475655 3:43203717-43203739 TTTCTCTTACAGCTTGGGCAGGG - Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG + Intronic
957264884 3:77950165-77950187 CTGGCCATACAGCTTGCTCAGGG + Intergenic
961037731 3:123654103-123654125 CTCCTGGGACAGCTTTCGCAGGG - Intronic
967522302 3:190446968-190446990 CTGCTCTTTCAGCTTTTGCATGG - Intronic
973621892 4:52735169-52735191 CTGCTGGTAGAGGTTGGGCATGG - Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
1040088790 8:43373508-43373530 CTGCTCCTTCAGTTTGCCCATGG - Intergenic
1042450147 8:68935820-68935842 GTGCTAGGACAGCTTGAGCATGG - Intergenic
1049130216 8:140832814-140832836 GTGCACGTACACCTTGCCCATGG - Intronic
1059856426 9:118403228-118403250 CTGCTCTGACAGCTTATGCAGGG - Intergenic
1059923817 9:119186500-119186522 CTGCTCTGCCAGCTTGGGCATGG - Intronic