ID: 907509499

View in Genome Browser
Species Human (GRCh38)
Location 1:54947666-54947688
Sequence TCGGCTAGAAACAGGCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907509499_907509509 24 Left 907509499 1:54947666-54947688 CCACAATGCCTGTTTCTAGCCGA No data
Right 907509509 1:54947713-54947735 TCGAAATCAGGACCTTTGAGAGG No data
907509499_907509506 12 Left 907509499 1:54947666-54947688 CCACAATGCCTGTTTCTAGCCGA No data
Right 907509506 1:54947701-54947723 GGGCCTGGCTCCTCGAAATCAGG No data
907509499_907509502 -8 Left 907509499 1:54947666-54947688 CCACAATGCCTGTTTCTAGCCGA No data
Right 907509502 1:54947681-54947703 CTAGCCGAAGAACAGATCCAGGG No data
907509499_907509501 -9 Left 907509499 1:54947666-54947688 CCACAATGCCTGTTTCTAGCCGA No data
Right 907509501 1:54947680-54947702 TCTAGCCGAAGAACAGATCCAGG No data
907509499_907509504 -3 Left 907509499 1:54947666-54947688 CCACAATGCCTGTTTCTAGCCGA No data
Right 907509504 1:54947686-54947708 CGAAGAACAGATCCAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907509499 Original CRISPR TCGGCTAGAAACAGGCATTG TGG (reversed) Intergenic
No off target data available for this crispr