ID: 907511267

View in Genome Browser
Species Human (GRCh38)
Location 1:54962469-54962491
Sequence ATGCCCTTCTAGAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907511267_907511269 2 Left 907511267 1:54962469-54962491 CCTTCATTCTTCTAGAAGGGCAT No data
Right 907511269 1:54962494-54962516 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907511267 Original CRISPR ATGCCCTTCTAGAAGAATGA AGG (reversed) Intergenic
No off target data available for this crispr