ID: 907513543

View in Genome Browser
Species Human (GRCh38)
Location 1:54979655-54979677
Sequence GTTAGTCACCCCCAGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907513534_907513543 20 Left 907513534 1:54979612-54979634 CCGGCCAGGCTGCTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 402
Right 907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 69
907513535_907513543 16 Left 907513535 1:54979616-54979638 CCAGGCTGCTCCACCTTCTATCC 0: 1
1: 0
2: 1
3: 27
4: 255
Right 907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 69
907513541_907513543 3 Left 907513541 1:54979629-54979651 CCTTCTATCCTTGGGCTGGGAAG 0: 1
1: 0
2: 0
3: 14
4: 147
Right 907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 69
907513532_907513543 25 Left 907513532 1:54979607-54979629 CCCTGCCGGCCAGGCTGCTCCAC 0: 1
1: 0
2: 0
3: 52
4: 929
Right 907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 69
907513539_907513543 6 Left 907513539 1:54979626-54979648 CCACCTTCTATCCTTGGGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 213
Right 907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 69
907513533_907513543 24 Left 907513533 1:54979608-54979630 CCTGCCGGCCAGGCTGCTCCACC 0: 1
1: 0
2: 3
3: 25
4: 354
Right 907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 69
907513542_907513543 -5 Left 907513542 1:54979637-54979659 CCTTGGGCTGGGAAGAGAGTTAG 0: 1
1: 1
2: 3
3: 21
4: 274
Right 907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907513543 Original CRISPR GTTAGTCACCCCCAGCTCAC TGG Intergenic
907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG + Intergenic
910105373 1:83626306-83626328 ATTAGGCACTCCCAGCACACAGG + Intergenic
914986294 1:152460019-152460041 GTCAGTGAGCCCCAGCTCAGTGG + Intergenic
915586745 1:156847920-156847942 GTGAATCTCCCCCAGCTCCCCGG - Intronic
918216245 1:182393870-182393892 GTTTGTCATCCCCACCTCAGGGG - Intergenic
918563278 1:185895039-185895061 TTAAGTCACCCCCAACTCCCAGG - Intronic
921037954 1:211400431-211400453 GTTACTCAGGCTCAGCTCACAGG + Intergenic
924681155 1:246235571-246235593 GTGAGCCACCTCCAGCTCACAGG + Intronic
1077796039 11:5493213-5493235 ATTAGTCCACCCCATCTCACTGG + Intronic
1078753083 11:14183656-14183678 GATAATGACCCACAGCTCACAGG - Intronic
1085018856 11:73192498-73192520 GTGAGTCACCTCCACCTCCCAGG - Intergenic
1093926496 12:24913569-24913591 GTGAGTCATCCCCAGCTCATGGG - Intronic
1096092609 12:48913254-48913276 GTTAGTCATCCACAGGACACTGG + Intronic
1098686421 12:73426585-73426607 GTTAGATACCAACAGCTCACTGG - Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101647543 12:106645206-106645228 GTTAGTAAATCCCAACTCACTGG + Intronic
1102497656 12:113330502-113330524 GATAATCACTCCCACCTCACGGG + Intronic
1103510253 12:121468626-121468648 GTTAGTCACGTCCAGGCCACTGG + Intronic
1103943367 12:124512877-124512899 GTGAGTCACCCCCACTCCACAGG + Intronic
1105581694 13:21704058-21704080 GTGAGTCATCCCCAGCTCATGGG + Exonic
1117093176 14:52270044-52270066 GTTAGCAAACCACAGCTCACAGG + Intronic
1123665893 15:22609251-22609273 CTTGGTGACCCCCCGCTCACAGG + Intergenic
1124319717 15:28703664-28703686 CTTGGTGACCCCCCGCTCACAGG + Intronic
1124482795 15:30091766-30091788 CTTGGTGACCCCCCGCTCACAGG - Intronic
1124489248 15:30143837-30143859 CTTGGTGACCCCCCGCTCACAGG - Intronic
1124544335 15:30612828-30612850 CTTGGTGACCCCCCGCTCACAGG - Intronic
1124564298 15:30800264-30800286 CTTGGTGACCCCCCGCTCACAGG - Intergenic
1124754280 15:32394487-32394509 CTTGGTGACCCCCCGCTCACAGG + Intronic
1127533503 15:59867751-59867773 TATAGTCACCCCCTGCTCCCTGG - Intergenic
1131052870 15:89359796-89359818 GTGACTTTCCCCCAGCTCACTGG - Intergenic
1139276423 16:65731986-65732008 GTGAGTCACCCACAACTCACTGG + Intergenic
1139968757 16:70760881-70760903 GTGAGTCACTCCCAACTCGCAGG + Intronic
1140190848 16:72814869-72814891 ATTAGCCACCTGCAGCTCACTGG + Intronic
1142431845 16:90032893-90032915 GTTCTTCACCACCACCTCACTGG - Exonic
1144996376 17:19272112-19272134 GCTACTCACCCCCACCCCACAGG - Intronic
1150789836 17:68195281-68195303 GATAGTAACACCCACCTCACTGG - Intergenic
1152807218 17:82361835-82361857 GTTAGGCACCCCCAGCAGGCAGG - Intronic
1160799019 19:959063-959085 GTGAGTCACACACACCTCACGGG - Intronic
1161072694 19:2270512-2270534 GTGCGCCACCCCCAGCTCCCCGG - Intronic
1164336028 19:24322138-24322160 ATTACTCACGCTCAGCTCACAGG + Intergenic
1165826852 19:38710459-38710481 GGAAGCCACCCCCAGCTCCCTGG + Intronic
1166653585 19:44594012-44594034 GGAAGTCACCCCCAGAACACTGG + Intergenic
1167677539 19:50896672-50896694 TTTAGTCATGCCCTGCTCACTGG - Intergenic
1168236085 19:55063872-55063894 GTTTGTCACCCCCACCAAACCGG + Intronic
929976027 2:46635817-46635839 CTTAATTACCCCCAGCTCTCAGG + Intergenic
933659660 2:84916879-84916901 GTGAGACACCCCCCGCCCACTGG + Intergenic
939516544 2:143175639-143175661 GTTAGTCACCCCAAGATCTGTGG - Intronic
945024855 2:205610551-205610573 GTTAGTCATGCTGAGCTCACTGG + Intronic
1169805219 20:9552287-9552309 GTCAGTCACTCACTGCTCACTGG + Intronic
1174400118 20:50271441-50271463 CATTGTCACCCCCAGCTCAGTGG - Intergenic
1176085366 20:63293339-63293361 GTCAGTCACCCTCAGATCACAGG - Intronic
1178124044 21:29498510-29498532 GGTAGCCACCCCAAGGTCACAGG - Intronic
1183075793 22:35426061-35426083 GTCAGTCTCCCCCACCTGACTGG - Intergenic
950745095 3:15081755-15081777 GCTAGTCTTCCTCAGCTCACAGG + Intronic
951681659 3:25301271-25301293 GTTAGTCTCCCTCAGCTACCTGG + Intronic
969309381 4:6344258-6344280 ATTCTTCACCCCCAGCTCCCAGG - Intronic
969586704 4:8098031-8098053 GCTGGTCACCACCAGCTCAGAGG + Intronic
970696801 4:18687397-18687419 GTTGGTCACCACCATCCCACAGG - Intergenic
976530445 4:86146144-86146166 GTTATTCACTCTCAGCTCACTGG - Intronic
999982637 5:156972590-156972612 GTTTGTCACACCCTGGTCACAGG + Intergenic
1003429510 6:6026058-6026080 GCTGCTCACCTCCAGCTCACTGG - Intergenic
1004413724 6:15405420-15405442 GCTAGTCACCATCAGCTGACGGG - Intronic
1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG + Intergenic
1009061413 6:58401481-58401503 GTTACTCAGGCTCAGCTCACAGG + Intergenic
1009249081 6:61276033-61276055 GTTACTCAGACTCAGCTCACAGG + Intergenic
1024632791 7:51263119-51263141 GGGAGTTCCCCCCAGCTCACCGG + Intronic
1030172626 7:106619179-106619201 TTTACTGACCACCAGCTCACTGG - Intergenic
1039960035 8:42239261-42239283 GATGGTCACCCCAGGCTCACAGG - Intergenic
1044142799 8:88675415-88675437 GTTACTCAGGCCCAGCTCACAGG - Intergenic
1046417719 8:113938348-113938370 GTTTGTCACCTCTTGCTCACTGG + Intergenic
1052437105 9:28443718-28443740 CTGAGTCACCCTCAGCTCCCTGG - Intronic
1056508410 9:87279722-87279744 TTTAGTGACCCACAGCACACAGG + Intergenic
1058272084 9:102985517-102985539 GTAAGTCTCACCCAGCTCCCAGG - Intergenic
1061180212 9:129021098-129021120 GGTGGTCGGCCCCAGCTCACTGG + Exonic
1187018792 X:15358111-15358133 GGTACTCTTCCCCAGCTCACTGG + Exonic
1187256857 X:17651195-17651217 GTCTGTTATCCCCAGCTCACTGG + Intronic
1192718087 X:73664550-73664572 ATTAGTCACACCCAGGCCACTGG - Intronic