ID: 907516104

View in Genome Browser
Species Human (GRCh38)
Location 1:54994430-54994452
Sequence ACCAGGAGGCACCACTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907516100_907516104 16 Left 907516100 1:54994391-54994413 CCTTGGGTGAGTTAGGTGAGTTA No data
Right 907516104 1:54994430-54994452 ACCAGGAGGCACCACTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907516104 Original CRISPR ACCAGGAGGCACCACTTTAC TGG Intergenic