ID: 907518250

View in Genome Browser
Species Human (GRCh38)
Location 1:55006999-55007021
Sequence TACATAGGGCGGCTGGGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907518250_907518258 -10 Left 907518250 1:55006999-55007021 CCAGTCCCCAGCCGCCCTATGTA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 907518258 1:55007012-55007034 GCCCTATGTAAGGCTGTGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907518250 Original CRISPR TACATAGGGCGGCTGGGGAC TGG (reversed) Exonic
901758037 1:11453290-11453312 TACAGAGGCTGGCTGGGGGCTGG - Intergenic
901839366 1:11944508-11944530 AACAGGGGGCTGCTGGGGACAGG - Intronic
902639406 1:17756967-17756989 TACATAGGCAGGCCGGGCACAGG + Intronic
903866572 1:26402979-26403001 TACATTGGGAGGAAGGGGACAGG + Intergenic
904826742 1:33278029-33278051 TACAGAGTGCGGCTGGGGCCTGG - Intronic
905344482 1:37302166-37302188 ACCATAAGGAGGCTGGGGACAGG - Intergenic
906662140 1:47590580-47590602 TAGAGAGGGAGGCTGGGGTCAGG + Intergenic
906695430 1:47820269-47820291 TACATAGGAGGGCCTGGGACTGG - Intronic
907518250 1:55006999-55007021 TACATAGGGCGGCTGGGGACTGG - Exonic
915312559 1:155011737-155011759 TTCATGGGGCGTCAGGGGACTGG + Intronic
919937454 1:202264071-202264093 GAAATAGGGAGGCTGGGGAGGGG + Intronic
921029844 1:211327209-211327231 TCCAGAGGGCGGCTGTGGACCGG + Intronic
1064137288 10:12762012-12762034 TACATAGACCTGCTGGGGAGGGG - Intronic
1065474704 10:26121885-26121907 TTTATAGGGATGCTGGGGACAGG - Intronic
1070802581 10:79252191-79252213 TACATAGGCTGGGTGGGTACAGG - Intronic
1070841774 10:79492401-79492423 TGCAGAGTGCGGCTGGGGCCTGG - Intergenic
1072111337 10:92323024-92323046 TAAAGAAGGTGGCTGGGGACCGG - Intronic
1072462126 10:95629264-95629286 CAGATGGGGAGGCTGGGGACTGG + Intronic
1075107287 10:119548748-119548770 TACATCTGGCTGCTGGGGAAGGG - Intergenic
1076472211 10:130727172-130727194 TCCGTGGGGCGGCTGGGGCCTGG + Intergenic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1076911527 10:133392434-133392456 TACAGAGGGAGGCTGGGGCTCGG - Intronic
1077177254 11:1196521-1196543 TGCAGCGGGAGGCTGGGGACTGG - Intronic
1077992192 11:7422168-7422190 AACACAGGGCGGCTGTGGAGAGG + Intronic
1084283340 11:68114406-68114428 GACACAGGGAGGCTGGGCACAGG + Intronic
1086631830 11:89028935-89028957 TACGTAGGGGGGTGGGGGACTGG - Intronic
1090398443 11:126434081-126434103 CACACAGGCAGGCTGGGGACTGG - Intronic
1098358830 12:69635644-69635666 TACAAAGCGAGGCTGGGGAATGG + Intergenic
1105737798 13:23289303-23289325 CACATAGGAAGGCTGGGGAAAGG + Intronic
1110034814 13:70670024-70670046 TGCATAGAGGGACTGGGGACAGG - Intergenic
1110412902 13:75222963-75222985 TACATGGGAAGGCAGGGGACAGG - Intergenic
1114239031 14:20849037-20849059 GACAGAGGGCGGCCGGGGAGAGG + Intergenic
1118419247 14:65582499-65582521 TACTTAGGACAGCTGGGGATGGG - Intronic
1118639173 14:67776475-67776497 TACAAATGCAGGCTGGGGACTGG + Intronic
1122296160 14:100706755-100706777 CACAGAGGGCGGCTGGGTCCCGG + Intergenic
1124619181 15:31264464-31264486 TCCAGGGGGCGGCAGGGGACCGG + Intergenic
1130581666 15:85142854-85142876 TACCTATGGAGGCTGGGGAGGGG + Intergenic
1132834511 16:1946037-1946059 TACATCTGGGGGCTGGGCACGGG - Intronic
1136403691 16:30031357-30031379 CACAGGGGGCTGCTGGGGACAGG + Intronic
1145926809 17:28653946-28653968 TGCATACAGGGGCTGGGGACAGG + Intronic
1145975080 17:28979175-28979197 AACCCAGGGAGGCTGGGGACAGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149397869 17:56263196-56263218 TACATAGGCAGCCTGGGTACTGG + Intronic
1151453293 17:74212309-74212331 CACATATGGCTGCTGGGGAGTGG - Intergenic
1154483250 18:14856490-14856512 GACAATGGGCGGCTGGGGAGAGG + Intergenic
1154483669 18:14858110-14858132 GACAATGGGCGGCTGGGGAGAGG + Intergenic
1157427888 18:47599839-47599861 CACATAGGGGTGCTGGGGACAGG - Intergenic
1158235644 18:55310328-55310350 TAGATATGGAGGCTGGGCACGGG - Intronic
1159516919 18:69470386-69470408 CACATAGGGAGGCTGGAGCCAGG + Intronic
1163462816 19:17448845-17448867 TGCTTAGGGCGGCAGGGGGCGGG - Intronic
1163732763 19:18959449-18959471 TACTTTGGGAGGCTGGGGCCAGG + Intergenic
1164730210 19:30497902-30497924 TACATATGGCTGATGGGGACAGG - Intronic
1165139425 19:33689930-33689952 CACAGAGGGCTGCTGGGAACAGG + Intronic
1166558747 19:43718524-43718546 TTCAGAGGGTGGCGGGGGACAGG - Exonic
1167432950 19:49463916-49463938 CACATGGGGAGGCTGGGGGCAGG - Exonic
1168616838 19:57844653-57844675 TTCATAGGTCAGCTGGGTACAGG + Exonic
925891714 2:8439819-8439841 TACATTTGGAGGCTGGGGAAAGG - Intergenic
926347117 2:11957570-11957592 TACAGAGGGAGGCTGGAGACAGG + Intergenic
927928028 2:27026559-27026581 TAAATAGGGTGGGTGTGGACAGG - Exonic
940901454 2:159130036-159130058 TACCGGGGGCGGCGGGGGACTGG + Intronic
948405881 2:237718494-237718516 CACATAGGGAGGCTGCGGAAGGG + Intronic
948738041 2:240023102-240023124 TAAATTGGGCTGCTGGAGACAGG - Intronic
1169248792 20:4044744-4044766 GAGATAGGGCTGGTGGGGACTGG + Intergenic
1170030756 20:11941533-11941555 TACCTAGGGCATCTGGGGATGGG + Intergenic
1182547880 22:31086053-31086075 TACATTTGGAGGCTGGGGGCTGG - Intronic
1184313922 22:43667502-43667524 TACAGTGGCAGGCTGGGGACAGG + Intronic
1184403610 22:44287629-44287651 AACATAAGGCCGCTGGGGCCTGG - Intronic
950272245 3:11626938-11626960 TAGATAGGGTGGCTGGGGGTGGG + Intronic
953038755 3:39236570-39236592 AGCACAGGGTGGCTGGGGACAGG - Intergenic
956379711 3:68652851-68652873 AACATGGGGAAGCTGGGGACAGG + Intergenic
956440513 3:69276518-69276540 TACTTTGGGAGGCTGAGGACAGG - Intronic
962610720 3:137073840-137073862 TACATATGGTGGCTTGGGCCAGG + Intergenic
964485114 3:157178772-157178794 TAGATGGGGCGGCTGGGCAGAGG + Intergenic
969463784 4:7342985-7343007 GACATAGGGTGGCTGCAGACAGG + Intronic
969493214 4:7511655-7511677 TACCTCTGGGGGCTGGGGACAGG + Intronic
970246127 4:14065804-14065826 TACATAGGGTGGTTGGGGGTAGG + Intergenic
975702021 4:77075780-77075802 GCCATAGGGCGGCGGGGGCCGGG + Exonic
976774973 4:88698021-88698043 TACATGGGTGGGCTGGGAACAGG - Exonic
982746116 4:159104604-159104626 CACGGAGGGCGGCTGGGGAGAGG - Intronic
987219999 5:15781397-15781419 TACATTGGGAGGATGGGGAAAGG + Intronic
987255694 5:16148554-16148576 TCCATAGGTCGGGTGGGGACAGG - Intronic
988532814 5:32040809-32040831 TAGACAGGGCGGCTGGGCAGAGG - Intronic
991453481 5:66777783-66777805 TAGATAAGGCAGCTGGGGAGAGG + Intronic
997786831 5:136721273-136721295 TACATAGGGCAGGTGGGAAATGG + Intergenic
998952225 5:147403964-147403986 GACCTAGGGCCGCTCGGGACAGG - Intronic
1005883380 6:30076127-30076149 TACATCTGGGGGCTGGGGGCCGG + Intergenic
1006792945 6:36715616-36715638 TTCATGGAGCAGCTGGGGACTGG + Exonic
1008148807 6:47924850-47924872 TATATAAGGCGGTTGGGGAGAGG - Intronic
1009034986 6:58106344-58106366 TTCCTAGGGAGGCTGGGGAGAGG + Intergenic
1009210499 6:60857061-60857083 TTCCTAGGGAGGCTGGGGAGAGG + Intergenic
1015768121 6:136740242-136740264 TGCACAGCGGGGCTGGGGACGGG + Intronic
1029217427 7:98961335-98961357 TACTGAGGATGGCTGGGGACTGG - Exonic
1032403269 7:131638337-131638359 TAGAGAGGGAGGCTGGGGAATGG - Intergenic
1038762800 8:30400330-30400352 TACTTTGGGAGGCTGGGGAGTGG - Intronic
1040632496 8:49231796-49231818 TACATAGGATGGGTAGGGACAGG - Intergenic
1046609008 8:116403603-116403625 TACATAAGGGGGCTGGGGGCTGG - Intergenic
1058715374 9:107718013-107718035 TAGATGGGAAGGCTGGGGACAGG + Intergenic
1059241600 9:112810867-112810889 TTCACAGGGCGGTTGGGGAGTGG + Intronic
1061565694 9:131438271-131438293 GACATAGGCAGGCTGGAGACTGG + Intronic
1062125909 9:134862574-134862596 TCCATAGGGAGGCTGGGGGTGGG + Intergenic
1062430990 9:136526819-136526841 GACAAAGGGCGGCTGGGAGCAGG + Intronic
1186999379 X:15159323-15159345 TACATAGGGGAGGAGGGGACAGG + Intergenic
1189015382 X:37091569-37091591 TACTTTGGGAGGCTGGGGAGTGG - Intergenic
1195737886 X:108032567-108032589 TGCATAGGGCAACTGGGGAAGGG + Intergenic
1196031529 X:111098730-111098752 TACATGGGTGGGCTGGGGCCTGG + Intronic
1201898005 Y:19014800-19014822 TACAGAGGGAGGAAGGGGACAGG + Intergenic