ID: 907519625

View in Genome Browser
Species Human (GRCh38)
Location 1:55014717-55014739
Sequence ATCCCAGACTTTTCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907519625_907519633 25 Left 907519625 1:55014717-55014739 CCATCCTCAGAAAAGTCTGGGAT No data
Right 907519633 1:55014765-55014787 TGGTGATTCTTAAGTGCTGAAGG No data
907519625_907519631 5 Left 907519625 1:55014717-55014739 CCATCCTCAGAAAAGTCTGGGAT No data
Right 907519631 1:55014745-55014767 GGGTTTTGCATAAGCAAGCCTGG No data
907519625_907519634 26 Left 907519625 1:55014717-55014739 CCATCCTCAGAAAAGTCTGGGAT No data
Right 907519634 1:55014766-55014788 GGTGATTCTTAAGTGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907519625 Original CRISPR ATCCCAGACTTTTCTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr