ID: 907520575

View in Genome Browser
Species Human (GRCh38)
Location 1:55020846-55020868
Sequence CAGAGCACTGTGGAGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907520562_907520575 27 Left 907520562 1:55020796-55020818 CCCCTGGGCCATGCTTGGAGAAA No data
Right 907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG No data
907520565_907520575 19 Left 907520565 1:55020804-55020826 CCATGCTTGGAGAAACACTAGCA No data
Right 907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG No data
907520564_907520575 25 Left 907520564 1:55020798-55020820 CCTGGGCCATGCTTGGAGAAACA No data
Right 907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG No data
907520563_907520575 26 Left 907520563 1:55020797-55020819 CCCTGGGCCATGCTTGGAGAAAC No data
Right 907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907520575 Original CRISPR CAGAGCACTGTGGAGGGGTC TGG Intergenic
No off target data available for this crispr