ID: 907520887

View in Genome Browser
Species Human (GRCh38)
Location 1:55022570-55022592
Sequence CTGCGTTTATGGAGGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907520887_907520890 4 Left 907520887 1:55022570-55022592 CCTTCTCTCCTCCATAAACGCAG No data
Right 907520890 1:55022597-55022619 GCGCCACACAGCAATGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907520887 Original CRISPR CTGCGTTTATGGAGGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr