ID: 907522493

View in Genome Browser
Species Human (GRCh38)
Location 1:55033341-55033363
Sequence CCAGCCCAGCTCTTCCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907522488_907522493 -10 Left 907522488 1:55033328-55033350 CCCACACCAGCCTCCAGCCCAGC No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data
907522479_907522493 24 Left 907522479 1:55033294-55033316 CCCAGAATGGTTGGCGAGCTCCC No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data
907522486_907522493 -8 Left 907522486 1:55033326-55033348 CCCCCACACCAGCCTCCAGCCCA No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data
907522487_907522493 -9 Left 907522487 1:55033327-55033349 CCCCACACCAGCCTCCAGCCCAG No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data
907522480_907522493 23 Left 907522480 1:55033295-55033317 CCAGAATGGTTGGCGAGCTCCCC No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data
907522483_907522493 3 Left 907522483 1:55033315-55033337 CCCCAGGTCTGCCCCCACACCAG No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data
907522484_907522493 2 Left 907522484 1:55033316-55033338 CCCAGGTCTGCCCCCACACCAGC No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data
907522478_907522493 25 Left 907522478 1:55033293-55033315 CCCCAGAATGGTTGGCGAGCTCC No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data
907522485_907522493 1 Left 907522485 1:55033317-55033339 CCAGGTCTGCCCCCACACCAGCC No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data
907522482_907522493 4 Left 907522482 1:55033314-55033336 CCCCCAGGTCTGCCCCCACACCA No data
Right 907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907522493 Original CRISPR CCAGCCCAGCTCTTCCTTGC AGG Intergenic
No off target data available for this crispr