ID: 907522595

View in Genome Browser
Species Human (GRCh38)
Location 1:55033941-55033963
Sequence TCCCATAGCCCCAGAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907522595_907522600 -8 Left 907522595 1:55033941-55033963 CCTTGCCCTCTGGGGCTATGGGA No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data
907522595_907522599 -9 Left 907522595 1:55033941-55033963 CCTTGCCCTCTGGGGCTATGGGA No data
Right 907522599 1:55033955-55033977 GCTATGGGAAACAGCTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907522595 Original CRISPR TCCCATAGCCCCAGAGGGCA AGG (reversed) Intergenic
No off target data available for this crispr