ID: 907522600

View in Genome Browser
Species Human (GRCh38)
Location 1:55033956-55033978
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907522595_907522600 -8 Left 907522595 1:55033941-55033963 CCTTGCCCTCTGGGGCTATGGGA No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data
907522587_907522600 5 Left 907522587 1:55033928-55033950 CCTGAGCTCCAACCCTTGCCCTC No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data
907522583_907522600 26 Left 907522583 1:55033907-55033929 CCCGACCTCAGGAGGGAGAGCCC No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data
907522582_907522600 27 Left 907522582 1:55033906-55033928 CCCCGACCTCAGGAGGGAGAGCC No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data
907522591_907522600 -3 Left 907522591 1:55033936-55033958 CCAACCCTTGCCCTCTGGGGCTA No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data
907522593_907522600 -7 Left 907522593 1:55033940-55033962 CCCTTGCCCTCTGGGGCTATGGG No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data
907522585_907522600 21 Left 907522585 1:55033912-55033934 CCTCAGGAGGGAGAGCCCTGAGC No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data
907522586_907522600 6 Left 907522586 1:55033927-55033949 CCCTGAGCTCCAACCCTTGCCCT No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data
907522584_907522600 25 Left 907522584 1:55033908-55033930 CCGACCTCAGGAGGGAGAGCCCT No data
Right 907522600 1:55033956-55033978 CTATGGGAAACAGCTGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr