ID: 907523984

View in Genome Browser
Species Human (GRCh38)
Location 1:55043260-55043282
Sequence TCCAGATGCTCTACAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907523984_907523988 19 Left 907523984 1:55043260-55043282 CCTGCATTTGTAGAGCATCTGGA 0: 1
1: 0
2: 1
3: 6
4: 128
Right 907523988 1:55043302-55043324 TCACTCTTGACTTTCCCAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907523984 Original CRISPR TCCAGATGCTCTACAAATGC AGG (reversed) Intronic
901337434 1:8463267-8463289 TCCTGAGGCTCTACAAGGGCTGG + Intronic
901797896 1:11691338-11691360 TCCAGAGGCGCCACAACTGCCGG + Intronic
902226505 1:14999671-14999693 CCCAGTTGCTAAACAAATGCCGG - Intronic
902997439 1:20237755-20237777 TCCAGAAGCTAAACAAGTGCTGG + Intergenic
905251618 1:36652638-36652660 TCCAGTTGCTCCATAAATGGTGG - Intergenic
906203322 1:43973768-43973790 ACCAGATTCTCAACAAATGTGGG - Intergenic
907523984 1:55043260-55043282 TCCAGATGCTCTACAAATGCAGG - Intronic
911893037 1:103396881-103396903 CTCAGCTGCTCTACAAAAGCAGG - Intergenic
916272528 1:162958535-162958557 TCCAGCTGCTCTTCACCTGCGGG + Intergenic
920008714 1:202852395-202852417 TCCTGATGCCTTACAAACGCAGG - Intergenic
1063330545 10:5154817-5154839 TCCAGTTGCTCAACTACTGCAGG - Intergenic
1063690322 10:8280991-8281013 TCCAGAAGCCCAGCAAATGCTGG - Intergenic
1069639987 10:69948521-69948543 TCCAGATGCTCTAAGCACGCTGG + Intronic
1076316538 10:129546025-129546047 TCCAGTTGCTGTACAAGTGACGG + Intronic
1077411714 11:2406814-2406836 CCCACATGCTCTAGTAATGCTGG - Intronic
1078518285 11:12043556-12043578 TCCAGATGCTCTTCAAGTTACGG - Intergenic
1079939602 11:26662383-26662405 TGCAGATGCTATAAAAATGGAGG - Exonic
1099155203 12:79166746-79166768 TCCAGATGCTATACAAATGTTGG + Intronic
1111207424 13:85029456-85029478 AGCAGATACTCTAAAAATGCAGG + Intergenic
1112394958 13:99021154-99021176 ACCACATGCTCAATAAATGCTGG + Intronic
1112661729 13:101517658-101517680 TCCAGATGTTCAAGAAATACAGG + Intronic
1112667269 13:101590090-101590112 TTCAGATGCTCTAGACCTGCAGG - Intronic
1113145445 13:107202860-107202882 TCCTGTTCCACTACAAATGCTGG + Intronic
1115069549 14:29304274-29304296 TCCACATTCTTTGCAAATGCTGG - Intergenic
1117896671 14:60494730-60494752 TTCAGTTGCTCTACCACTGCAGG + Intronic
1117950655 14:61079919-61079941 TCTAGAAGCTCTACACATGCTGG - Intronic
1118020388 14:61707037-61707059 CCCAAATGCTTTACAAATACAGG - Intronic
1119868205 14:77991638-77991660 TTCAGCTGCCCTACAAAGGCAGG - Intergenic
1125143462 15:36438004-36438026 TAAAGATGCTCTACAAAGCCAGG - Intergenic
1128661131 15:69501793-69501815 TCCAGAAGCTCTCCAAACCCAGG - Intergenic
1129572275 15:76700479-76700501 TCCTGGTGCTCTACAAAGCCAGG + Intronic
1131207990 15:90467762-90467784 TTCAGATGTTTTACAAATTCAGG - Intronic
1132156477 15:99499316-99499338 TCCAGAGGCTCAGCAAATGTAGG - Intergenic
1137333327 16:47523551-47523573 ACTGGATGCTCTACAAAAGCAGG - Intronic
1138722913 16:59102632-59102654 TTAAGATGCTCAACAAGTGCTGG - Intergenic
1139229152 16:65265962-65265984 CCCAGATTCTCTGCAAATGATGG + Intergenic
1142001775 16:87668390-87668412 TCCAGATCCTGTTCAAATCCTGG + Intronic
1143050457 17:4121260-4121282 TCCTGATGCTATCCACATGCTGG + Intronic
1143316107 17:6034688-6034710 TGCAGATCCTCTTAAAATGCAGG - Intronic
1144609518 17:16697437-16697459 TCCAGCTGCTCTCCATATGAGGG - Intronic
1144903253 17:18618114-18618136 TCCAGCTGCTCTCCATATGAGGG + Intergenic
1144927814 17:18827871-18827893 TCCAGCTGCTCTCCATATGAGGG - Intergenic
1145129319 17:20328638-20328660 TCCAGCTGCTCTCCATATGAGGG - Intergenic
1146520559 17:33522313-33522335 TCCGAATGCTCTGCAAATGTAGG - Intronic
1150554532 17:66242092-66242114 TCCAGAAGCCCAGCAAATGCTGG + Intronic
1152333936 17:79689568-79689590 TCCACATGGTCTGCAGATGCCGG - Intergenic
1154974292 18:21442126-21442148 TCCAGGTGGTCTACAAGTGGAGG + Intronic
1155400890 18:25437875-25437897 TCCAGACGCTCAACAATTTCTGG + Intergenic
1155532728 18:26783556-26783578 ACCAGATGCCCTTCAAAGGCTGG - Intergenic
1156470364 18:37373906-37373928 GCCAGATGATCTACAGTTGCTGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166267114 19:41691115-41691137 AACAGATGCTCAACAAATACTGG - Intronic
1168356883 19:55706093-55706115 TCCAGATTCTCTGCATGTGCAGG + Intronic
925577406 2:5374723-5374745 TCCAGATGGGCTACAGTTGCAGG + Intergenic
927038949 2:19208728-19208750 TCCAGCTACACTATAAATGCTGG + Intergenic
928748504 2:34443601-34443623 TTCAGATAATCAACAAATGCTGG - Intergenic
929332770 2:40704029-40704051 TCCAGATATCCTCCAAATGCAGG + Intergenic
929718792 2:44344293-44344315 AGCAGATGCTCAAAAAATGCTGG + Intronic
931032132 2:58188647-58188669 CCCAGATGGTCTCCAACTGCTGG + Intronic
931998833 2:67864977-67864999 GCCAGATACTGTGCAAATGCTGG - Intergenic
937277702 2:120695965-120695987 TGTAGATGCTCAATAAATGCTGG - Intergenic
940571047 2:155434006-155434028 TCCAGACTATCTACAAATGTTGG + Intergenic
941356268 2:164496285-164496307 TCCAAATGCAGTACAAATGAGGG - Intronic
946730192 2:222702004-222702026 TCCAGGTGCTAGGCAAATGCAGG + Intronic
1168748902 20:268210-268232 TACAGATGCTGTACATGTGCGGG + Intergenic
1168861849 20:1051469-1051491 AGCAAATGCTCAACAAATGCTGG + Intergenic
1172853054 20:37980587-37980609 CCCAGATGCTCTGCGAAGGCAGG + Intergenic
1174690723 20:52501742-52501764 TCAAGATGCAGAACAAATGCAGG + Intergenic
1175063881 20:56268907-56268929 GCAAGAGGCCCTACAAATGCAGG + Intergenic
1175952739 20:62592121-62592143 CCCAGGTGCTCTTCAGATGCAGG + Intergenic
1177216891 21:18141770-18141792 TCCTGCTGATCTACAAATGTAGG - Intronic
1180151208 21:45948990-45949012 TCCAGGTGCTCTTCCAAAGCAGG - Intergenic
1181384569 22:22534613-22534635 TCAACATGGTCTACAGATGCTGG + Intergenic
1182191744 22:28468240-28468262 TGCAGCTGATCTACAAATGCTGG + Intronic
952506121 3:34008227-34008249 ACCAGAAGCTCTCCAAGTGCTGG + Intergenic
953445447 3:42960958-42960980 TCCAGATGGACTATAAATGGGGG - Intronic
956531485 3:70224425-70224447 TCCAGATGTTCTATAAAAGGTGG + Intergenic
957309284 3:78499011-78499033 TACAGATGCTTTACATATGCAGG + Intergenic
961484239 3:127206413-127206435 TCCTGTTGCTCTTCCAATGCTGG - Intergenic
962938954 3:140108149-140108171 TCCAGTGGTTCTACAAATACAGG + Intronic
963519405 3:146345821-146345843 TCCAGGAGCTCTACATATTCTGG - Intergenic
968474056 4:794891-794913 ACCTGGTGCTCTATAAATGCCGG - Intronic
968861216 4:3171965-3171987 TTCAGGGGCTCTACAGATGCAGG + Intronic
969369380 4:6721445-6721467 TCCAGGAGCTCTTCAGATGCTGG + Intergenic
970356422 4:15258125-15258147 TCCAGAACCTCTACAATTGTGGG - Intergenic
970446015 4:16123926-16123948 TCCAGATGGTGTAGAAAGGCTGG - Intergenic
970607931 4:17698357-17698379 TCCAGATTGTCTACAATTACAGG + Intronic
972159852 4:36210434-36210456 TGCAGATGCTCCATAAAAGCAGG + Exonic
972306260 4:37832964-37832986 TCCAGATTCTCTAAAAATCTCGG - Intronic
973667223 4:53174593-53174615 TCAAAATGCTCCAAAAATGCTGG + Intronic
974773491 4:66447714-66447736 TCCAGATTCTCTACATTTACAGG - Intergenic
976045984 4:80948364-80948386 TCCAGATGTTATACAGCTGCAGG - Intronic
976202337 4:82591779-82591801 TCCAGGTGCTATCCAAATACTGG + Intergenic
978496753 4:109367838-109367860 TCCAAATGCTATAGAAATTCAGG + Intergenic
979270742 4:118757987-118758009 ACCAGATGCTCTAGATATTCTGG - Intronic
982313600 4:154009891-154009913 ACCAGATGTTTTTCAAATGCAGG + Intergenic
987079978 5:14417798-14417820 TACATATGCTCTAAAAATGAAGG - Intronic
988682264 5:33495573-33495595 GCCAGACTCTCTACAAATTCCGG - Intergenic
989456783 5:41653302-41653324 GCCACATGCTCTGCAAAGGCAGG + Intergenic
990784782 5:59407319-59407341 TCCAGAAGCTTAGCAAATGCTGG + Intronic
991109785 5:62886651-62886673 TCCAGATGCTCAAGAGAAGCAGG - Intergenic
992187963 5:74262099-74262121 TCCAGATGGACTGCACATGCTGG - Intergenic
996470604 5:123855805-123855827 TCCAGATGCTCCAGTGATGCTGG - Intergenic
996989339 5:129609702-129609724 ACCAGATTCTCTCCAAATGTAGG + Intronic
998789968 5:145755785-145755807 AGCAGATGCTCAATAAATGCTGG + Intronic
1002566980 5:180117669-180117691 CGCAGAGGCTCCACAAATGCAGG + Intronic
1002787674 6:416720-416742 TCCATTTGCTCAACAAATACAGG + Intergenic
1003646727 6:7918685-7918707 GTCAGAGGCTCCACAAATGCAGG + Intronic
1006861662 6:37175467-37175489 ACCAAATGCTCAATAAATGCAGG - Intergenic
1009594474 6:65716797-65716819 TCCAGAAGCTCTCCAAACCCAGG + Intergenic
1012015620 6:93846286-93846308 GACAGTTGCTCTAAAAATGCTGG - Intergenic
1015332835 6:132001425-132001447 CCAAGATACTCTACAAATGTTGG - Intergenic
1021636776 7:22701645-22701667 TCTAAGTGCTCTACAAATCCAGG - Intergenic
1021747217 7:23754351-23754373 TTCAGATGCTATACAAGTGTTGG + Exonic
1023083364 7:36546143-36546165 TCCAGTTACTCAACAAATACTGG - Intronic
1023354050 7:39349565-39349587 TCCAGACCCTCTTAAAATGCAGG - Intronic
1028709840 7:93894221-93894243 GAGAGATGCTCTAGAAATGCTGG + Intronic
1031578539 7:123444375-123444397 TCCATATGCTGTTCAAATGTAGG + Intergenic
1031633533 7:124073622-124073644 TGCAGATGCAACACAAATGCTGG - Intergenic
1035288441 7:157821430-157821452 CCCACATGCTCTCCAAATGCTGG - Intronic
1037719117 8:21427653-21427675 TCCAGCTTCTCTGCAAATACAGG - Intergenic
1038002983 8:23406016-23406038 ACCAGATGCTCAATAAATGCTGG + Intronic
1041168862 8:55119926-55119948 TAAAGATGCTCTGTAAATGCAGG + Intronic
1042344840 8:67716873-67716895 GCCAACTGCTCCACAAATGCAGG + Intronic
1043510867 8:80949011-80949033 CCCAGATTCTCTGCAGATGCTGG - Intergenic
1046426756 8:114062433-114062455 TCCTCATGTTCTATAAATGCTGG + Intergenic
1047093341 8:121597163-121597185 TCCAGATGCTCTCTGAATCCAGG - Intergenic
1048258618 8:132925666-132925688 GCCAGATGCTTCACAAATGAAGG + Intronic
1049149829 8:141027332-141027354 TTCAGATGCTCCACCATTGCTGG + Intergenic
1051340840 9:16108824-16108846 ACCAGAAGCTGAACAAATGCTGG + Intergenic
1053473130 9:38360892-38360914 AACAGATGCTCAGCAAATGCTGG + Intergenic
1054957355 9:70928054-70928076 TCCAGATGGCCTACAAATATGGG - Intronic
1055522606 9:77096822-77096844 GTCAGCTGCTCTACAAATTCAGG + Intergenic
1185481333 X:448655-448677 TCCGGGTGCTCTCCAATTGCTGG + Intergenic
1185645219 X:1610865-1610887 TCCAGATGCTCCACCCATGCAGG + Intergenic
1188876109 X:35432003-35432025 TACAGATTCTTTACAGATGCAGG + Intergenic