ID: 907524781

View in Genome Browser
Species Human (GRCh38)
Location 1:55047794-55047816
Sequence GGCCACAGGCTGCCCAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 575}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907524781_907524789 2 Left 907524781 1:55047794-55047816 CCCGGCCTGGGCAGCCTGTGGCC 0: 1
1: 0
2: 7
3: 85
4: 575
Right 907524789 1:55047819-55047841 GGAGAGGACAGCTCCTCTGTAGG No data
907524781_907524791 27 Left 907524781 1:55047794-55047816 CCCGGCCTGGGCAGCCTGTGGCC 0: 1
1: 0
2: 7
3: 85
4: 575
Right 907524791 1:55047844-55047866 GAGCCTGTTCCTTTCCAACCAGG 0: 1
1: 0
2: 0
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907524781 Original CRISPR GGCCACAGGCTGCCCAGGCC GGG (reversed) Intronic
900179532 1:1305151-1305173 GGCACCAGGCTGCCCCAGCCAGG + Intronic
900341291 1:2190538-2190560 GGCCACACCTTGGCCAGGCCTGG - Intronic
900359006 1:2279006-2279028 GGCCACAGCCTGCCCTTGTCTGG - Intronic
900409385 1:2505972-2505994 GGCCACAGGCCCCCCAACCCGGG + Intergenic
900537666 1:3186923-3186945 GGCCACTGGCTGACCGGGGCAGG - Intronic
900546891 1:3234399-3234421 CTCCCCAGGCTGCCCCGGCCAGG + Intronic
900793777 1:4695400-4695422 GGCCAACGGCTGGCCAGGCAAGG + Intronic
900995845 1:6123279-6123301 GGTTAGTGGCTGCCCAGGCCTGG + Intronic
901037108 1:6343049-6343071 GCCCTCAGGCTTCCCAGGGCGGG + Intronic
901631288 1:10649400-10649422 TTCAGCAGGCTGCCCAGGCCAGG + Exonic
902374684 1:16024817-16024839 GGCCACAGGGTACACAGTCCAGG - Exonic
902379631 1:16046589-16046611 GGCCACAGGGTACACAGTCCAGG - Exonic
902552691 1:17228861-17228883 GCCCCCAGCCTGCCCAGCCCTGG - Intronic
902618751 1:17638374-17638396 TGCCCCAGGCTTCCCAGCCCTGG - Intronic
902778089 1:18687353-18687375 GGTCTCAGGCTGCCGAGACCAGG + Intronic
902796953 1:18806274-18806296 GGCCACAGGAAGGCCAGCCCTGG - Intergenic
902822600 1:18952331-18952353 GGACCCAGGCACCCCAGGCCAGG + Intronic
903190016 1:21651176-21651198 GGCCACTGGCTGCCTGGGCTTGG - Intronic
903212168 1:21824418-21824440 GAGCAGAGGCTGCCGAGGCCAGG + Exonic
903276981 1:22228632-22228654 GGGCACAGGCTGCCCAGGAGTGG + Intergenic
903355911 1:22747243-22747265 GGCCACAGATAGCCCAGGCAAGG + Intronic
904009060 1:27379739-27379761 GGCCACAGGCTTGCCTGGGCTGG + Exonic
904373297 1:30064482-30064504 AGGCCCAGGCTGCCCAGGCATGG - Intergenic
904625448 1:31799627-31799649 GGCCACTGGCTGCCTGGGCTTGG - Intronic
905166502 1:36086242-36086264 GGATACCGGCTGCCCAGGGCAGG - Intronic
905505738 1:38477555-38477577 GGTTACAGGCTGGCCAGACCTGG - Intergenic
905542824 1:38773814-38773836 GGCCAGAGTCTGTGCAGGCCGGG + Intergenic
905865382 1:41373691-41373713 GGCCCCAGGCTGCCCACTCTAGG + Intronic
905878630 1:41449277-41449299 GGCAGCTGGGTGCCCAGGCCTGG + Intergenic
905990717 1:42335056-42335078 TACCTCAGGCTGCGCAGGCCGGG + Intronic
906105009 1:43286341-43286363 AGCCACAGGCTGTCAAAGCCTGG - Intergenic
906212408 1:44019571-44019593 GGGCTCTGGCTGCCCTGGCCTGG + Intronic
906460478 1:46032276-46032298 GGCCTCATGCTGCCAAGGGCTGG - Exonic
906567668 1:46812438-46812460 AGCCCCAGGCTGCCAGGGCCTGG + Intronic
906652354 1:47521740-47521762 GGTAACAGGCTGCCCCGGCCAGG + Intergenic
907412179 1:54290545-54290567 GGCCTCAGACTTCCCAGCCCAGG - Intronic
907524781 1:55047794-55047816 GGCCACAGGCTGCCCAGGCCGGG - Intronic
911060511 1:93744004-93744026 GGCCTCAGGCTAATCAGGCCTGG - Intronic
911154152 1:94622867-94622889 GGCCACAGGCAGGTCAGGCCAGG - Intergenic
914248102 1:145900784-145900806 GGCCCCATCCTGCCCAGGTCAGG - Exonic
915737785 1:158095488-158095510 GGCCAAAGCCTGCCCATCCCTGG - Exonic
915916069 1:159941750-159941772 TGCCTCCGCCTGCCCAGGCCTGG - Intronic
915984207 1:160447228-160447250 AGCCACAGGCTGCCCAGACTAGG - Intergenic
916802247 1:168226202-168226224 CCCCGCAGGCTTCCCAGGCCCGG - Intronic
916923935 1:169498008-169498030 GGCCTCAGGCTCCCCAGGGAAGG + Intergenic
916982836 1:170157016-170157038 GCTCACAGGCTGCCCAGGGTTGG - Intronic
918070014 1:181127885-181127907 AGCCACAGGCAGGCCAGGCGCGG - Intergenic
918124968 1:181575229-181575251 GGCCACAGGCTGCATGGCCCTGG + Intronic
919463146 1:197902548-197902570 GGCCACGAGCTGCCCAAGACCGG + Intergenic
919746407 1:201011719-201011741 CCTCAGAGGCTGCCCAGGCCAGG - Intronic
920039247 1:203085200-203085222 GGCCACAGTCAGCCCAGGTGAGG - Intronic
920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG + Intergenic
922563633 1:226587109-226587131 CGCCACAGAGTGCCCAGGCTGGG + Intronic
922738870 1:228004826-228004848 GAGCTCAGCCTGCCCAGGCCAGG - Intergenic
922766940 1:228160901-228160923 GGCCACAGGGTGCCCAGATATGG - Intergenic
922886906 1:229027411-229027433 TTTAACAGGCTGCCCAGGCCCGG + Intergenic
923207868 1:231776138-231776160 GGTCACAGGCTGCCCTCCCCTGG - Intronic
1062927680 10:1329107-1329129 TGCCACAGGCTGCCCACACTGGG - Intronic
1063216764 10:3932370-3932392 TGCCACAGGCCTCCCATGCCTGG - Intergenic
1064373452 10:14774490-14774512 GGCCACAGGCTGCACACGGACGG + Exonic
1066064216 10:31750506-31750528 GCCCAGCGGCTGCCCAGGGCCGG - Intergenic
1067068662 10:43117438-43117460 AGCCCCAGGCTGCCCACACCTGG + Intronic
1067069070 10:43119436-43119458 GGCCGCAGGGTCCCCAGGCCCGG - Intronic
1067205217 10:44207042-44207064 TCCCGCAGTCTGCCCAGGCCTGG + Intergenic
1069719294 10:70539496-70539518 GGCCACAGCCTGCCATGGCCAGG - Intronic
1069802075 10:71087938-71087960 GGCCTCAGGTTGACCAGCCCTGG - Intergenic
1070309471 10:75262860-75262882 GACCTCAGCCTGCCCTGGCCAGG + Intergenic
1070502493 10:77084588-77084610 AGCCACAGACTGCCAAGCCCAGG + Intronic
1071430483 10:85602786-85602808 CCCAACAGGCTGACCAGGCCTGG - Intronic
1072227943 10:93387445-93387467 GGCCTCAGGCTTCCCAGCACAGG - Intronic
1072682264 10:97516108-97516130 GGCCAGGGGCTCCCCAAGCCTGG + Intronic
1072687378 10:97546296-97546318 GGCCACAGGAGGGCCAGGCATGG + Intronic
1072757316 10:98030015-98030037 GGCCAGTGGCTTCCCAGGCCCGG + Intronic
1073060282 10:100729810-100729832 GGCCACAGCCTGCCCACCACGGG + Intergenic
1073186920 10:101620557-101620579 GCCCACAGGCTGGCCAGAGCGGG + Intronic
1073301036 10:102471082-102471104 GGACCCAGGGTGCTCAGGCCTGG + Exonic
1073447654 10:103591004-103591026 GGCTGCAGCCTGCCCAGGACGGG - Exonic
1073475247 10:103748379-103748401 GGCCACAGGTTGCACAGCCCGGG - Intronic
1074314020 10:112345768-112345790 GGCCAGAGCCTGCCCAGACCAGG - Intergenic
1075016732 10:118915172-118915194 TGCCACTGCCTGCCCAGGGCAGG + Intergenic
1075100601 10:119503566-119503588 GCCCACACGCTGCCCAGCGCAGG - Intronic
1075198732 10:120383438-120383460 CACCAAAGGCTCCCCAGGCCTGG - Intergenic
1075550657 10:123390415-123390437 GGCCTCAGGCAGATCAGGCCAGG + Intergenic
1075683706 10:124349742-124349764 GACCACAGGCTGACAAGCCCAGG - Intergenic
1075713404 10:124542654-124542676 GGCCCCAGGGTGCACAGGGCTGG - Intronic
1076372739 10:129965323-129965345 GCCCACAGTCTGCCCGCGCCCGG - Intergenic
1076699765 10:132265344-132265366 TGCCACACTCAGCCCAGGCCTGG + Intronic
1076718900 10:132384066-132384088 GGCCTCAGCCTGGGCAGGCCGGG + Intergenic
1076796282 10:132799895-132799917 CCCCACAGGCTGGCCAGGGCTGG - Intergenic
1076872371 10:133200304-133200326 GGCCACAGTCTCCACAGGGCGGG - Intronic
1076898826 10:133327110-133327132 AGCCACTGGCTGCCCAGGGCGGG - Intronic
1076979665 11:197784-197806 GGCCTGAGGCTGCGCAGGGCAGG - Intronic
1077040420 11:518750-518772 GGCCCCGGGCTGCCCACGACGGG + Intergenic
1077048046 11:554910-554932 GGACACAGCCCGCCCAGCCCCGG + Exonic
1077147627 11:1053050-1053072 GGCCACAGAGGGCACAGGCCGGG + Intergenic
1077158965 11:1104015-1104037 GGCCACAGGCAGGCCTGGGCGGG - Intergenic
1077173895 11:1180177-1180199 GGCCACAGGCGGCGGAGCCCAGG - Intronic
1077431893 11:2519953-2519975 GGCCACATGCTGCACAGCACGGG + Intronic
1077437448 11:2549702-2549724 GGCCCTGGGCTCCCCAGGCCTGG + Intronic
1077500810 11:2909115-2909137 GTCCAGGGGCTGCCCAGGCGGGG - Intronic
1078091225 11:8265911-8265933 GGCCACAGCTAGCCCAGTCCTGG - Intronic
1078358560 11:10650740-10650762 AGCCTCAGGCAGCCCAGCCCAGG - Intronic
1078580300 11:12534379-12534401 GAACACAGGCTGCTCAGCCCAGG - Intergenic
1078654128 11:13222407-13222429 GGCAACTGCCTACCCAGGCCTGG + Intergenic
1078773417 11:14372178-14372200 GGCCACCAGCAGGCCAGGCCAGG + Intergenic
1079188712 11:18259942-18259964 GGCCACAGGCCTCACAGGGCAGG - Intergenic
1079192781 11:18294928-18294950 GGCCACAGGCTGCACAAGGTTGG + Intronic
1079327957 11:19510702-19510724 GGCAACAGGTTACCCAGCCCAGG + Intronic
1080639862 11:34152358-34152380 GGGCGGAGGCTGCCGAGGCCAGG - Exonic
1081573341 11:44304564-44304586 GGCCTCAGGCACCCCAGTCCAGG + Intronic
1083260243 11:61518651-61518673 GGCCACGGGCTGCCGGGGACGGG + Exonic
1083307681 11:61769618-61769640 GGGTGCAGGCTTCCCAGGCCGGG + Intronic
1083619601 11:64042373-64042395 GGCCATCTGTTGCCCAGGCCTGG + Intronic
1083693881 11:64429735-64429757 GGCCAAGGGCAGCCCAGGCAGGG + Intergenic
1084007829 11:66332538-66332560 GCCCACAGGCTGCCCACCACTGG - Exonic
1084087474 11:66861202-66861224 GGTCGGAGGCTGCCCGGGCCTGG - Intronic
1084321935 11:68377994-68378016 GGCCACAGGCCACCCAGGAAAGG - Intronic
1084674007 11:70623907-70623929 GTCCACACCCTGCCCTGGCCTGG - Intronic
1084916240 11:72431130-72431152 GCCTGCAGGCTGCCCAGACCAGG - Intronic
1084944167 11:72629949-72629971 GAACAGAGTCTGCCCAGGCCTGG - Intronic
1084959427 11:72708676-72708698 GGCCAAAGGCCCACCAGGCCTGG + Intronic
1085253537 11:75159401-75159423 GGCAACCGCCTGCCCAGCCCAGG + Intronic
1085401516 11:76238710-76238732 GGCCCCAGCAGGCCCAGGCCGGG + Intergenic
1086981857 11:93206986-93207008 GGTCAGAGGCTGCCCTGGCAAGG - Intergenic
1087105641 11:94404024-94404046 GGGCTCAGGAGGCCCAGGCCTGG - Intergenic
1088783519 11:113160093-113160115 GGCCACAGTCTCTCCAGGCATGG - Intronic
1089190363 11:116649080-116649102 GGCCACAGGGTGGGCAGGCTGGG - Intergenic
1089566592 11:119375065-119375087 GGCCAGAGGCTGGCCAGGCTGGG - Intronic
1090449207 11:126791348-126791370 GGCTGCATGCAGCCCAGGCCAGG - Intronic
1090800977 11:130171941-130171963 ACCGACAGACTGCCCAGGCCAGG - Intronic
1090828747 11:130406157-130406179 GACCAGTGGCTGCCCAGCCCAGG + Intronic
1091047446 11:132337042-132337064 GGACACTGGCAGCCCTGGCCAGG - Intergenic
1091256069 11:134187125-134187147 GGTCACAGTCTGCCCAGGTGGGG - Intronic
1091310652 11:134573192-134573214 TGCCTCAGGCGGCCCAGGCCAGG + Intergenic
1091330675 11:134728902-134728924 GGCCACGGGCCCCTCAGGCCAGG - Intergenic
1091450341 12:568909-568931 GGCCACAGGCTGCTCACAACAGG + Intronic
1096241286 12:49961666-49961688 GGCCGGCGGCTGCCCCGGCCGGG + Intergenic
1097193544 12:57231764-57231786 GGTCAAAGGCTTCCAAGGCCCGG - Exonic
1097891286 12:64780556-64780578 GGCCACCTGCTGCCCGGGCCCGG - Intergenic
1098425878 12:70365874-70365896 GGACACGAGCCGCCCAGGCCGGG - Intergenic
1098550447 12:71755447-71755469 GTCTACAGGCTGCCCCGACCTGG - Intronic
1101897178 12:108765598-108765620 GGCCACTGGCTGCTCGGCCCTGG - Intergenic
1101910482 12:108857384-108857406 GGCGTCCGGCGGCCCAGGCCGGG + Intronic
1102246940 12:111362026-111362048 TGCCTCAGCCAGCCCAGGCCAGG + Exonic
1102470686 12:113158238-113158260 GGGAACAGGATGCCCAGCCCAGG - Exonic
1103723131 12:122985303-122985325 GGCCACGGGCTGGACGGGCCTGG - Exonic
1103912527 12:124360255-124360277 GGCCCCAGGTAGCCCAGCCCTGG + Intronic
1104082785 12:125445659-125445681 GCTCACAAGCTGGCCAGGCCTGG + Intronic
1104412640 12:128572209-128572231 GGCCTCTGGTTGGCCAGGCCTGG + Intronic
1105545066 13:21345144-21345166 GGCCCCATGCTGCCCAGTCCTGG - Intergenic
1109915888 13:68984789-68984811 GGCGACACGCGGCCCAGGGCTGG + Intergenic
1112499944 13:99935147-99935169 GGCCACAGGTTGCCAAGACCCGG + Intergenic
1113658232 13:112083974-112083996 GGACAGAGGCCCCCCAGGCCTGG - Intergenic
1118348592 14:64957779-64957801 GGCCAGAGGCTTCCCAACCCTGG + Intronic
1118500934 14:66362024-66362046 GGCCACAGGCTGCCAGAGCAGGG - Intergenic
1118760466 14:68877910-68877932 GCCCACAGGCTGTCCAGCGCAGG - Intronic
1119031215 14:71194120-71194142 GTCTTCAGGCTGCCGAGGCCAGG + Intergenic
1119757717 14:77130631-77130653 GGTCTCAGGCTTCCCAGCCCTGG - Intronic
1120073365 14:80127656-80127678 GGCCAAAGTTTGCACAGGCCAGG - Intergenic
1120570929 14:86116095-86116117 GTCCTGAGGCTGCACAGGCCTGG - Intergenic
1120732998 14:88023609-88023631 GGCCATAGGCTGGCTATGCCTGG - Intergenic
1120846982 14:89134797-89134819 GGACACAGCTAGCCCAGGCCTGG - Intronic
1120882975 14:89428903-89428925 CTCCGGAGGCTGCCCAGGCCAGG + Intronic
1121180707 14:91926383-91926405 GGCCACGCGGTGCCCAGGCCTGG - Intronic
1121272129 14:92644800-92644822 GGCCCAAGCCTGCCCATGCCAGG - Intronic
1121718010 14:96089902-96089924 GACCCCAGGCTCCCCAGGACAGG + Exonic
1122017117 14:98805659-98805681 CCCCACATGCTGCCCTGGCCTGG + Intergenic
1122101828 14:99418563-99418585 TGCCACAGGCTGTCCTGCCCAGG - Intronic
1122112388 14:99511549-99511571 AGCCACAGACTGCGAAGGCCTGG - Exonic
1122774199 14:104110077-104110099 GGCCTCGGGCAGCCCAGGCTGGG - Intronic
1122794536 14:104199475-104199497 GGACACAGGCTGAGCAGGTCAGG + Intergenic
1122803890 14:104247131-104247153 GGCCACAGGGTGCCCTGGCCGGG + Intergenic
1122902674 14:104788261-104788283 AGGCACAGGCAGCCCTGGCCTGG + Intronic
1122930808 14:104932383-104932405 GGCCCCAGGGTGGCCAGGCACGG + Intronic
1122973951 14:105163504-105163526 AGCCACACCCTGCTCAGGCCTGG + Intronic
1123037174 14:105476203-105476225 AGCCCCAGGCTGGCCTGGCCCGG - Intronic
1123195703 14:106614421-106614443 GGCCAGAGGCTGCACAGGTGAGG + Intergenic
1123476262 15:20594138-20594160 GCCCACAGGAGGCCCAGACCAGG - Intergenic
1123641750 15:22406226-22406248 GCCCACAGGAGGCCCAGACCAGG + Intergenic
1124619051 15:31263886-31263908 AGCCACATGCTAGCCAGGCCCGG + Intergenic
1124879895 15:33632214-33632236 GGCCATTGACTGCCTAGGCCAGG - Intronic
1125599110 15:40906118-40906140 GGCCCCAGGCTTCCCTGGCAGGG + Intergenic
1126448115 15:48773323-48773345 GACAACAGGCAGCACAGGCCAGG + Intronic
1126795993 15:52260981-52261003 GGCCTCAGGCTGTCAACGCCAGG - Exonic
1128149718 15:65355462-65355484 GGCCCCAGGCTCCCCGGCCCAGG + Intronic
1128247522 15:66143341-66143363 GTCCGCAGGCTGCCTCGGCCTGG - Intronic
1128265697 15:66265093-66265115 AGGCCCAGGCAGCCCAGGCCTGG - Intergenic
1128329651 15:66747270-66747292 GGCCTCTGGCTGCCAAGGCCTGG + Intronic
1128370546 15:67036037-67036059 AGCCACAGTCTCCCCAGGCTGGG + Intergenic
1129108503 15:73324284-73324306 ATGCACAGCCTGCCCAGGCCAGG + Intronic
1129665191 15:77575700-77575722 GGTCCCTGGCTGCCCAGTCCAGG + Intergenic
1129755716 15:78097873-78097895 GGTCACAGGCAGCCCAGCCTTGG - Intronic
1129879282 15:78996399-78996421 GTCCCCACGCAGCCCAGGCCTGG - Intronic
1130330586 15:82919065-82919087 GGCCACAGGAGTCCCAGGGCTGG + Intronic
1132356618 15:101175535-101175557 AGCCAGACGCGGCCCAGGCCCGG + Intergenic
1132534641 16:472033-472055 GGCAGCAGGCTGACCAGGACTGG - Intronic
1132536662 16:484931-484953 GGCCACATGCTGCTGAGGTCAGG - Intronic
1132542259 16:516036-516058 GGCCACGGGGTGCCCGGGACAGG - Intronic
1132608448 16:803212-803234 GACCACAGCCTCCCGAGGCCAGG + Intergenic
1132775050 16:1588864-1588886 GGCCACAGCCCTGCCAGGCCAGG - Intronic
1132809513 16:1790820-1790842 AGCCACAGGCGCTCCAGGCCCGG + Exonic
1132831214 16:1929434-1929456 GGACCCAGGCTGCCCGGACCTGG - Intergenic
1132860774 16:2070718-2070740 GGCCGCAGCCTCCCCAGTCCTGG + Intronic
1132909899 16:2304132-2304154 CGCCACTGGATGCCCATGCCTGG + Exonic
1132939239 16:2498806-2498828 GGCCACATGCTGTCCAAGGCTGG - Intronic
1134610165 16:15601628-15601650 TGCAACAGGCTCCCCAGGCTTGG + Intronic
1135322598 16:21507298-21507320 GGCCGCAGGCTGCGCTGGGCGGG - Intergenic
1136187947 16:28599177-28599199 GGTCACAGGCAGCCCAGGACAGG + Intergenic
1136190419 16:28612171-28612193 GGTCACAGGCAGCCCAGGACAGG + Intronic
1136316587 16:29458053-29458075 GGTCACAGGCAGCCCAGGGCAGG - Intronic
1136334075 16:29600435-29600457 GGCCGCAGGCTGCGCTGGGCGGG - Intergenic
1136431163 16:30197395-30197417 GGTCACAGGCAGCCCAGGGCAGG - Intronic
1136461217 16:30411381-30411403 TGCTACAGGGAGCCCAGGCCAGG + Intronic
1136778709 16:32884698-32884720 GGCCACAGGCTTCCCAAGCCTGG + Intergenic
1136891909 16:33976816-33976838 GGCCACAGGCTTCCCAAGCCTGG - Intergenic
1136994566 16:35181100-35181122 GTCCAGAAGCTTCCCAGGCCAGG - Intergenic
1137483291 16:48870299-48870321 GCCCACATGCTGCCTGGGCCTGG + Intergenic
1137668568 16:50266198-50266220 GCCCACAGGAGGCTCAGGCCAGG + Intronic
1138137303 16:54534389-54534411 GGCCATAGGCTGCCCTGGTCAGG + Intergenic
1138267759 16:55672041-55672063 GGCCACAGTCGGTCCAGGGCAGG - Exonic
1138453406 16:57106869-57106891 AGCCTCAGGCTCCCCTGGCCTGG + Intronic
1138593058 16:58013156-58013178 AGAGGCAGGCTGCCCAGGCCTGG - Intronic
1139512507 16:67435614-67435636 AGTCACAGCCTGGCCAGGCCAGG - Exonic
1139612972 16:68072210-68072232 GGACAAAGGCTGCCCAGCTCTGG - Intronic
1139652638 16:68370317-68370339 GGCCACTAGCTTCCCTGGCCTGG - Intronic
1140098631 16:71895776-71895798 CGCAGGAGGCTGCCCAGGCCTGG + Intronic
1140467496 16:75194177-75194199 GGGCACAGGATGGCCAGGCCTGG + Intergenic
1140470106 16:75209111-75209133 GGCCACAGGTCACTCAGGCCAGG - Intergenic
1141479917 16:84299689-84299711 GGGGCCAGCCTGCCCAGGCCAGG - Intronic
1141556544 16:84840186-84840208 TGCCACAGGCTGAGCTGGCCTGG + Intronic
1141766419 16:86062674-86062696 TGCCGCAGGCTGACCAGGCAGGG + Intergenic
1141827610 16:86492170-86492192 GGCTACAGGCAGCCAAGGGCTGG - Intergenic
1141854038 16:86668966-86668988 GGCCACACTCTCTCCAGGCCTGG + Intergenic
1142034843 16:87856527-87856549 GGCCACAGGCTGCACTGGGCGGG - Intronic
1142124516 16:88403550-88403572 GGCCACCGTCTGCAGAGGCCAGG + Intergenic
1142138657 16:88462912-88462934 GACCACAGGGGGCCCTGGCCCGG - Intronic
1142177227 16:88650838-88650860 GGCGCCAGGCGGGCCAGGCCGGG - Intronic
1203081126 16_KI270728v1_random:1146792-1146814 GGCCACAGGCTTCCCAAGCCTGG + Intergenic
1142757297 17:2023946-2023968 CGCCACAGCCTGCTCGGGCCTGG + Intronic
1142855063 17:2724593-2724615 GGTCCCAGGCGGCCCAGTCCCGG + Intergenic
1143479608 17:7220731-7220753 GGGGACAGGCTGGTCAGGCCAGG - Intronic
1143972128 17:10803477-10803499 GGCCACAGGATCCCCAGTCAGGG + Intergenic
1144208067 17:12993222-12993244 GGGCAGAGGCTCCCCAGGCCTGG + Intronic
1144674018 17:17150256-17150278 GGCCACAGGCTTGACAGGCAGGG + Intronic
1144701602 17:17344246-17344268 AGCCACAGGCTGCCCAAGGAAGG - Intronic
1144778080 17:17794924-17794946 GGCCTCCGGCTCCCCAGGCCGGG - Exonic
1144855260 17:18264009-18264031 GGCACCAGGCTCCACAGGCCCGG - Exonic
1145031984 17:19511192-19511214 GGACACTGCCTGGCCAGGCCTGG + Intronic
1145058183 17:19716626-19716648 CGACACGGGCTGCCCAGGCAGGG - Intronic
1145061716 17:19738183-19738205 GGACACAGTATGGCCAGGCCAGG + Exonic
1145911988 17:28548307-28548329 GGCCACAGGATGCTGAGGCCTGG + Intronic
1145938070 17:28726543-28726565 GGCCACCGGCTACCCCGCCCTGG + Intronic
1146208049 17:30921904-30921926 GGCTGGCGGCTGCCCAGGCCTGG + Exonic
1146257309 17:31399005-31399027 GGCCGAAGGTTGCCCAGGCCGGG - Intronic
1147196164 17:38768263-38768285 AGCCACAGGCTGCTCTGGCCAGG - Exonic
1147260379 17:39206650-39206672 GGACACCTGCTTCCCAGGCCTGG + Intergenic
1147658125 17:42102426-42102448 AGGCACAGACTTCCCAGGCCAGG + Intronic
1147746127 17:42695716-42695738 GGGCACAGGCCGACCAGGCCGGG - Exonic
1147891465 17:43720552-43720574 GGCCACAGCCGGACCAGGCCAGG + Intergenic
1148475837 17:47928037-47928059 GTCCACAGTCTGGGCAGGCCGGG - Exonic
1149659316 17:58326124-58326146 GGGCAGAGGCTGGCCAGGCAAGG - Intronic
1151304702 17:73255846-73255868 TGCCACCTGCTGGCCAGGCCAGG - Intronic
1151505462 17:74524296-74524318 GGTCCCAGGCTGTCCAGGCACGG + Intronic
1151575139 17:74949410-74949432 GGCCTGAGGCTGCCCACCCCCGG + Exonic
1151632467 17:75320239-75320261 GGTCACAGGGTGACCCGGCCAGG + Exonic
1151671529 17:75574014-75574036 GGCCACACCCGGCCCAGACCTGG + Intronic
1151675489 17:75595318-75595340 CGGCCCAGGCTGCCCAGCCCAGG - Intergenic
1151678625 17:75612811-75612833 CGCCAGTGGCTGCCCTGGCCTGG - Intergenic
1151782810 17:76258542-76258564 GGCCCCCAGCTGCCCAGGCCAGG - Intergenic
1151850676 17:76687928-76687950 GGCTACAGGCAGGCCAGGGCAGG + Intronic
1152237865 17:79147769-79147791 GCCCACCGGCAGCCCTGGCCAGG - Intronic
1152349518 17:79777267-79777289 GGACGCCGGCTGCCCAGCCCTGG + Intergenic
1152824991 17:82458947-82458969 GGGCCCAGGGTGCCGAGGCCGGG - Intronic
1152855539 17:82663203-82663225 GGAGACAGGCTCCCCAGGACTGG + Intronic
1153161068 18:2205107-2205129 GGCCACTGGCACCACAGGCCTGG + Intergenic
1153359177 18:4174275-4174297 GTCCACAGGCAGCTCAGGGCAGG - Intronic
1153893618 18:9540106-9540128 CACCACAGGCTGGCGAGGCCAGG + Intergenic
1154070823 18:11149737-11149759 GCCCACTGGCAGGCCAGGCCGGG - Intergenic
1154155166 18:11938648-11938670 GGCCAGAGGCAGCCCACGCTGGG + Intergenic
1154501189 18:14998792-14998814 GGCCCCAGTCCGCCCAGGCTGGG + Intergenic
1156460503 18:37319014-37319036 GGCCTCTGGCTGCCCCCGCCTGG + Intronic
1156480327 18:37432271-37432293 GGGCACAGGCTCCAGAGGCCCGG + Intronic
1156486955 18:37472384-37472406 GGCCCCTGGCTGCCCAGGTCTGG - Intronic
1157224926 18:45854035-45854057 GGCCCTGGGCTGCCCAGGCCTGG - Intronic
1157415404 18:47498184-47498206 ACCCACAGGCTGGCGAGGCCTGG + Intergenic
1157606377 18:48928562-48928584 GTCCACTGTCTGCCCAGGCTTGG + Intronic
1157799612 18:50608849-50608871 GGCCACAGGGTCCCCTGCCCAGG - Intronic
1158019964 18:52830205-52830227 GGCCACATGCAGCCCATGACCGG + Intronic
1158456593 18:57613601-57613623 GTCCACAGGCTGCGCAGGCAAGG - Exonic
1159015501 18:63098988-63099010 TGTCTCAGGCTGTCCAGGCCTGG + Intergenic
1159375005 18:67581947-67581969 GTCTACAGGCTGCCCAGGGATGG - Intergenic
1159851298 18:73529906-73529928 GGTCACTGGCTGCTGAGGCCTGG - Intergenic
1160027308 18:75229078-75229100 GGCCACAGTCAGCCCTGGGCGGG + Intronic
1160390473 18:78527616-78527638 GGCCACACGGTGTCCAGCCCAGG + Intergenic
1160745904 19:710482-710504 AGCCACACCCTGCCCAGGCCTGG - Intronic
1160808955 19:1004721-1004743 CCCCACAGGGTGCCCAGGTCTGG + Exonic
1160989569 19:1855066-1855088 GGCCAGAGGCTGCGAGGGCCTGG - Intronic
1161156812 19:2736077-2736099 GGCCACAGTGTGACCAGCCCTGG - Intronic
1161405852 19:4090766-4090788 GGCCAGCGTCTGCCCAGCCCTGG + Intronic
1161558817 19:4959352-4959374 AGCCACAGGCTGCCTGGGGCAGG + Intronic
1161857201 19:6772785-6772807 GGCTACCGCCTGCCCAGGGCCGG - Exonic
1162016969 19:7851312-7851334 AGCCTCAGGCTGCCCAGCGCAGG + Intronic
1162736580 19:12750310-12750332 GGTCACAGGGTGACCAGCCCAGG + Intergenic
1162777091 19:12986260-12986282 GGCCACAGGAGGCCCTGGCCAGG + Intergenic
1163502864 19:17686866-17686888 GGACACAGGGTGGGCAGGCCGGG - Intronic
1163787325 19:19281574-19281596 GGCGACAGCCTTCCCAGGTCGGG - Intronic
1165890614 19:39110172-39110194 GACCAGAAACTGCCCAGGCCTGG + Exonic
1166111807 19:40627262-40627284 GGCCAGCGGGTGCCCGGGCCAGG - Exonic
1166334131 19:42095314-42095336 GCCCCCATGCTGCCCAGCCCAGG - Exonic
1166759499 19:45215824-45215846 GGTCACAGGAAGCCCAGGGCAGG - Intronic
1166942541 19:46375526-46375548 GCCCCCAGGCTGCCCAGCCCTGG - Intronic
1166965458 19:46527128-46527150 GTCCCCAGGCTGCCCAGCCCTGG + Intronic
1166978101 19:46616906-46616928 GGCCACAGCCTGCCATGGCAAGG - Intergenic
1167044654 19:47042586-47042608 GGCCACCGGCTATCCAGGTCTGG + Intronic
1167201169 19:48066540-48066562 GGCCACACACAGCCCTGGCCAGG + Intronic
1167568625 19:50272710-50272732 AGCTGCAGGCTGCCCTGGCCAGG + Exonic
1167783121 19:51613453-51613475 GGCCATAGGCTGCCTAGGTCAGG + Intronic
1168257794 19:55176065-55176087 TGCCACCTGCTGCCCTGGCCCGG + Exonic
1168713236 19:58513413-58513435 GCCCACAGGCTGTCCTGGGCAGG - Intergenic
925402646 2:3586601-3586623 GAGCACAGTGTGCCCAGGCCAGG - Intergenic
927138832 2:20115966-20115988 GGCCACAGGTTTCTCAGGCATGG + Intergenic
927149836 2:20189168-20189190 GGCCAGAGGCTGCCCAAGAAGGG - Intergenic
927168626 2:20350446-20350468 GGCCCCAGGCCGCACCGGCCCGG + Intronic
930024921 2:47024089-47024111 GCCCACAGGCAGCCCAAGGCAGG - Intronic
930029533 2:47049653-47049675 GGCCAGAAGCTCCCCAGGCCAGG - Intronic
931160463 2:59684548-59684570 GGCCAAAGACTGGCCAGGTCAGG + Intergenic
932405802 2:71512034-71512056 GGTTGGAGGCTGCCCAGGCCTGG + Intronic
933832419 2:86221714-86221736 GGCCACTGTGTGCCCAGCCCTGG - Intronic
934117728 2:88812337-88812359 AGCCACCGGCATCCCAGGCCAGG + Intergenic
934649602 2:96083414-96083436 GGCCCCTGGCTGGCCAGCCCCGG - Intergenic
934751932 2:96799323-96799345 GGCAGCAGGCTCCCCAGGCAGGG - Intronic
934776472 2:96940950-96940972 GGCCACAGCCTGCACAAGGCAGG - Intronic
935187674 2:100748528-100748550 ACCAACAGGCTTCCCAGGCCAGG - Intergenic
935547484 2:104416457-104416479 GGGCACAGGCAGCCAGGGCCAGG - Intergenic
935783004 2:106524383-106524405 TGCCTTAGGCTTCCCAGGCCTGG - Intergenic
936428180 2:112436703-112436725 GGCCACAGGCTGACCCGTGCAGG + Intergenic
937252527 2:120533751-120533773 GGCCCCAGCCTGTCCACGCCGGG - Intergenic
937470241 2:122168284-122168306 TGCAACAGGCTGCTCAGGGCAGG + Intergenic
938232308 2:129671644-129671666 AGCCACAGGCTCCCCAGCCATGG - Intergenic
938500348 2:131828960-131828982 GGCCCCAGTCCGCCCAGGCTGGG + Intergenic
939135068 2:138283975-138283997 GGCCACAGAGTGCCCAAGCCTGG + Intergenic
940066456 2:149635055-149635077 TGCCTCAGGCTGCCTAGGCAAGG - Intergenic
942302108 2:174572158-174572180 GGCCCCAGGCAGCCCAGCCCCGG - Exonic
942745137 2:179223255-179223277 GGCCAGTGGCTGCCTAGGGCTGG + Intronic
944270998 2:197785497-197785519 GGCCACAGGCGGGCCCTGCCAGG + Intronic
944662425 2:201932337-201932359 AGCCACTGGCTGCCCAGGCAAGG - Intergenic
945319558 2:208406450-208406472 GGCTAAAGGCTCCCGAGGCCAGG - Intronic
945884875 2:215364436-215364458 GGTCTCAGGCTGCCCAGGATGGG + Intronic
946167830 2:217876164-217876186 GCCTGCAGGCTGACCAGGCCTGG - Intronic
946426036 2:219597652-219597674 AGCCCCAGGCTGCGCAGGGCGGG + Intergenic
947187966 2:227472102-227472124 GGCTACCGGCCGCCCAGGGCGGG + Intergenic
947541271 2:230981449-230981471 AGCCAGAGGCTTCACAGGCCTGG - Intergenic
947874345 2:233458519-233458541 GGCCACGAGCTGTCCAGGACAGG - Intronic
947948457 2:234126824-234126846 GGCCACAGGGTGGGCAGGGCAGG - Intergenic
948455185 2:238101529-238101551 GGCCACAGGGTCCCGGGGCCAGG - Intronic
948757899 2:240169811-240169833 GGCCACACACTTCACAGGCCAGG - Intergenic
948823892 2:240565066-240565088 GGCCACAGGATGTCCAGGAGAGG - Intronic
948867380 2:240782788-240782810 TGCAGCAGGCAGCCCAGGCCTGG - Intronic
948940048 2:241190980-241191002 GGGCACAGGATGCGCAGGCGCGG - Intronic
1168876872 20:1177891-1177913 GGCCAGAGGCTGGTCAGGTCAGG - Intronic
1168910153 20:1440905-1440927 GGCCACACTCTTCCCAGGCCAGG - Intergenic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG + Intergenic
1170831816 20:19849387-19849409 GGACACAGGCTCCCAAGGTCAGG + Intergenic
1171263954 20:23755233-23755255 GGCTACAGCCTGCAGAGGCCTGG + Intergenic
1171476694 20:25415400-25415422 GGCCACACTGTGCCCAGCCCGGG - Intronic
1172032614 20:31992491-31992513 GCTCACACGCTGCCCAGGACAGG - Intronic
1172528591 20:35616128-35616150 GCCCTCGGGCTCCCCAGGCCCGG - Exonic
1172881296 20:38201521-38201543 GCCCTGAGGCTGCCCTGGCCTGG + Intergenic
1173551091 20:43933709-43933731 GGCCATGGGCTGCCCAGGACAGG + Intronic
1173725233 20:45292934-45292956 GGCCACAGGCTGGACAGACAGGG + Intergenic
1173725417 20:45293743-45293765 GGCCACGGACGGCCCAGACCCGG - Exonic
1173799661 20:45887018-45887040 TGGCACCTGCTGCCCAGGCCTGG - Exonic
1174191987 20:48747391-48747413 GGACACTGGATGCCCAGGGCGGG + Intronic
1174619064 20:51860127-51860149 GCAGACAGGCTGCCCAGCCCAGG + Intergenic
1174729468 20:52901527-52901549 GTCCACAAACTGCCCAGTCCAGG - Intergenic
1175299742 20:57934445-57934467 GCCCTCAGGCTGCACCGGCCTGG - Intergenic
1175350375 20:58313754-58313776 GGCCACAGTTTGCCCACCCCTGG - Intronic
1175951796 20:62587621-62587643 GGGCACAGGCAGACAAGGCCCGG + Intergenic
1176181597 20:63752101-63752123 GGGCACAGGCAGCCCAGAGCGGG - Intronic
1176189252 20:63800133-63800155 TGCCCCAGGGTGCCGAGGCCGGG - Intronic
1176373172 21:6074614-6074636 GGGCACAGACTGCTCAGGGCAGG + Intergenic
1176374071 21:6078508-6078530 GGCCACAGGCTGACCCGTGCAGG - Intergenic
1176382088 21:6118628-6118650 GGACACTGGCTGGCCAGGCTGGG - Intronic
1176388685 21:6152302-6152324 ACCCACAGGCTGTCCTGGCCAGG - Intergenic
1176521698 21:7829578-7829600 GGCCACAGACAGCCCCGCCCCGG + Intronic
1176553717 21:8243421-8243443 GGCCAGAATCTGCCAAGGCCCGG - Intergenic
1176572639 21:8426445-8426467 GGCCAGAATCTGCCAAGGCCCGG - Intergenic
1176580548 21:8471006-8471028 GGCCAGAATCTGCCAAGGCCCGG - Intergenic
1177897250 21:26868283-26868305 GGTCACAGGGTGCCCAGATCTGG - Intergenic
1178387192 21:32162318-32162340 GGCCAGGGGCTTCCCATGCCTGG - Intergenic
1178495361 21:33081366-33081388 GTCAACAGGCTTCCCAGCCCGGG - Intergenic
1178655718 21:34459590-34459612 GGCCACAGACAGCCCCGCCCCGG + Intergenic
1179249105 21:39658009-39658031 GGACACAGGCTGCCCTTTCCAGG + Intronic
1179734787 21:43385946-43385968 ACCCACAGGCTGTCCTGGCCAGG + Intergenic
1179741384 21:43419611-43419633 GGACACTGGCTGGCCAGGCTGGG + Intronic
1179749406 21:43459735-43459757 GGCCACAGGCTGACCCGTGCAGG + Intergenic
1179750305 21:43463629-43463651 GGGCACAGACTGCTCAGGGCAGG - Intergenic
1179821298 21:43938907-43938929 AGCCGCAGCCTTCCCAGGCCTGG - Intronic
1179826818 21:43970810-43970832 GGCCCCAGACTGCCCGAGCCGGG + Intronic
1179878614 21:44284230-44284252 GCCCTCTCGCTGCCCAGGCCTGG - Intergenic
1179916372 21:44480755-44480777 AGCCCCTGGCTGCCCAGGGCCGG + Intergenic
1180011363 21:45053676-45053698 TTCCACAGTCTGCCCTGGCCAGG + Intergenic
1180066793 21:45416368-45416390 GGGCACAGTCTCCCCACGCCTGG + Intronic
1180179200 21:46110522-46110544 GGCCCCAGGCTGAGCAGGTCTGG + Intronic
1180220384 21:46354764-46354786 GGCCACAGGGTGTCCAGGCAGGG + Intronic
1180825628 22:18858950-18858972 GGGCACAGGCTGCTCACCCCAGG - Intronic
1180999932 22:19983285-19983307 GGCCCCAGGGGGCCCAGGCAAGG - Intronic
1181106746 22:20580146-20580168 GGCCACCAGCTGCCCTGACCTGG + Intronic
1181474432 22:23159620-23159642 GGCCACAGGGTGGCAGGGCCAGG + Intronic
1181826492 22:25520346-25520368 GCCCACAGACTGCTGAGGCCCGG + Intergenic
1182421940 22:30252820-30252842 GGCCTCAGGCTGCCCTGGGAAGG - Intergenic
1182429300 22:30290652-30290674 GGCCTCAGGGTGCTCAGGCCAGG - Intronic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182900028 22:33890055-33890077 GCCCACTGGCTCCTCAGGCCTGG + Intronic
1183357485 22:37367427-37367449 CAGGACAGGCTGCCCAGGCCAGG + Intergenic
1183422568 22:37720567-37720589 GGCCCCAGAGTGCCCAGGCTTGG + Intronic
1183477418 22:38043124-38043146 GGCCCCTTGCTCCCCAGGCCAGG - Intergenic
1183724500 22:39580975-39580997 CACCACCGGGTGCCCAGGCCTGG - Intronic
1183870334 22:40736971-40736993 GCCCCAAGGCTGCCCAGGCCCGG - Intergenic
1183948448 22:41339747-41339769 GTCCTGATGCTGCCCAGGCCTGG + Intronic
1184229862 22:43152549-43152571 TGCCTCAGGCTGCCCTGTCCCGG - Intronic
1184286730 22:43476238-43476260 GGCCACAGGGTGCCCAGTGCTGG + Intronic
1184633642 22:45807282-45807304 GGGCACAGGCAGCCCATGCAAGG + Intronic
1184690816 22:46116535-46116557 TGGCCCAGGCTGCCCAGGCGGGG - Intergenic
1184851585 22:47124402-47124424 GAGGACAGGCTGCCCACGCCAGG + Intronic
1184943675 22:47786182-47786204 GACCACAGGATGCCAAGGCAGGG - Intergenic
1185009512 22:48305389-48305411 GACCACTGACTGCCCAGGTCTGG + Intergenic
1185024821 22:48402877-48402899 GGCCACTCACTGCCCAGGTCTGG + Intergenic
1185024835 22:48402945-48402967 GGCCACTCGCTGCCCAGGTCTGG + Intergenic
1185024848 22:48403013-48403035 GGCCACTCGCTGCCCAGGTCTGG + Intergenic
1185044899 22:48523903-48523925 CACCACAGGCCGCCCAGGCGAGG + Intronic
1185050979 22:48553780-48553802 GGCCACAGGCTGAACAGACGAGG - Intronic
1185070081 22:48651372-48651394 GGGCACAGCCTCCCCAGACCTGG - Intronic
1185126074 22:49011573-49011595 AGCCACAGGCTCCCCGGGGCCGG - Intergenic
1185147526 22:49147348-49147370 AGACACAGGCTCCCCCGGCCCGG + Intergenic
1185326233 22:50227111-50227133 GGGCTCAGGGTTCCCAGGCCTGG + Intronic
1185346154 22:50311736-50311758 CCCAACAGGCTGCCCAGGACAGG - Exonic
1203214859 22_KI270731v1_random:536-558 GGGCACAGGCTGCTCACCCCAGG + Intergenic
1203258721 22_KI270733v1_random:160453-160475 GGCCAGAATCTGCCAAGGCCCGG - Intergenic
950075064 3:10181178-10181200 GGCCACAGCCTCCCCATTCCTGG + Intronic
951055844 3:18145537-18145559 GGCCATAGTTTGCCCATGCCTGG - Intronic
952419361 3:33117627-33117649 GGCCACAGCCAGGCAAGGCCTGG - Intronic
953022152 3:39121486-39121508 CTTCTCAGGCTGCCCAGGCCGGG + Intronic
953044191 3:39280802-39280824 CGCCCCAAGCTGGCCAGGCCAGG - Intronic
953405198 3:42656504-42656526 TGTCCCAGGCTGTCCAGGCCTGG - Intronic
953817417 3:46170671-46170693 GGACACAGTCTCCCCAGGCCTGG + Intronic
953876798 3:46671268-46671290 GGCCCCAGGGTCCCCAGGGCTGG + Intronic
954333512 3:49903285-49903307 GGCCACAGGCTGCACACGTCTGG + Exonic
954453214 3:50582864-50582886 AGCCACTGGCTGCCCTGGCCTGG - Exonic
954622186 3:52002594-52002616 GGCCTCAGGCAGCCAAGGACTGG + Intergenic
954701179 3:52451647-52451669 GGCCACAGGGTCCCTAGGCCTGG + Intronic
954713204 3:52514947-52514969 GGCATCAGGCAGTCCAGGCCTGG - Intronic
954809681 3:53240306-53240328 GGCCACTGGCTCCCTGGGCCAGG - Exonic
955085237 3:55696358-55696380 GGCCACAGGAAGGCCAGGGCTGG + Intronic
955215174 3:56979414-56979436 TGCCACAGGAGGCCCAAGCCAGG + Intronic
955217511 3:56996783-56996805 GGCCACAGGTTGCACAAGCTTGG - Intronic
957677799 3:83393090-83393112 TGCCACATGCTCCCCAGGTCTGG - Intergenic
959922713 3:111886339-111886361 GGCCACAGGTTGGACAAGCCTGG - Intronic
961035289 3:123637785-123637807 GGCCCCAGGCTGGCCAGCCTTGG + Intronic
961518740 3:127455126-127455148 AACCACAGGGAGCCCAGGCCAGG + Intergenic
961662276 3:128475667-128475689 GGCCACAAAGTGCCCAGGCATGG - Intergenic
963332116 3:143926200-143926222 GTCCACAGGTTGCCCAGGGTGGG - Intergenic
963797659 3:149647374-149647396 GGCCACTGGCTGCCCAGGCAGGG + Intronic
963843367 3:150130557-150130579 GGCCACACTCTTCCCAGGCAGGG - Intergenic
964007728 3:151851886-151851908 GGCCACAGTCTCCACAGACCAGG - Intergenic
965087217 3:164114051-164114073 GGCCACAGGCAGCCCAGAAAAGG - Intergenic
968489928 4:884488-884510 CTCCACGCGCTGCCCAGGCCTGG + Intronic
968678080 4:1896292-1896314 GGCTGCAGGCTGCCCATGGCAGG - Intronic
968728754 4:2260111-2260133 GGCCTGAGGCAGCCCAGGGCTGG - Intronic
969103264 4:4785831-4785853 GGCCACGTGGAGCCCAGGCCCGG - Intergenic
969122434 4:4920119-4920141 CGCCGCTGGTTGCCCAGGCCAGG + Intergenic
969341369 4:6543773-6543795 GGCAACTGGATGTCCAGGCCTGG - Intronic
969413567 4:7044441-7044463 AGCCCCAGGCCTCCCAGGCCAGG - Intronic
969606752 4:8205769-8205791 GACCACAGGGTGGCCTGGCCCGG - Intronic
969625955 4:8305907-8305929 AGGCACAGCCTTCCCAGGCCCGG - Intronic
971420736 4:26471925-26471947 TGCCCCAGGGTGACCAGGCCTGG + Intergenic
973339097 4:48986181-48986203 TGCCAGAGCCTGGCCAGGCCGGG - Intergenic
975673583 4:76805078-76805100 GGTCTCAGACTGCCCAGGCAGGG - Intergenic
979547230 4:121951789-121951811 GGCCCCGGGCGGCCCAGGGCGGG + Intergenic
984219159 4:176952321-176952343 GGCCACAGGCTGGCGTGGGCAGG - Intergenic
985487490 5:159658-159680 GGCCACAGGCTTCCTAGCCAGGG - Intronic
985647508 5:1091932-1091954 GGCCACAAGCTCCCCGAGCCGGG + Intronic
985710987 5:1429827-1429849 GAGCACATGCAGCCCAGGCCTGG + Intronic
985717310 5:1469876-1469898 GGAGGCAGGCTGCCCAGGCCTGG + Intronic
986169361 5:5303368-5303390 GGGCACAGGCTGGCCGGGACTGG - Exonic
986646625 5:9922576-9922598 TGCCTCAGGCTGGCCAGGGCTGG - Intergenic
988074905 5:26339714-26339736 GGCCACAGGCTGTACAGTCATGG + Intergenic
988527352 5:31998826-31998848 GGCCACAGGTTGGCCAAGCTTGG + Intronic
989188472 5:38646924-38646946 GGCCCCAGGCTGCCCCAGGCAGG + Intergenic
989379283 5:40797939-40797961 GGACAGGGGCTGCCCAGCCCTGG + Intronic
990337707 5:54791632-54791654 GGCCACTGGCTCCATAGGCCAGG - Intergenic
990490593 5:56299372-56299394 GGGCAAAGGCAGCCCAGGCCGGG + Intergenic
992091578 5:73322535-73322557 GACCCCAGGCTGAGCAGGCCAGG - Intergenic
992641543 5:78772488-78772510 CGCCACAGGCAGCCAGGGCCGGG - Intergenic
993706329 5:91175818-91175840 GGCCACAGGCTTCCCGTTCCTGG + Intergenic
994627246 5:102235565-102235587 GGCCACACACAGCCCAGGGCTGG - Exonic
994748006 5:103702710-103702732 AGCCACAGGCTGGCCAGGCGCGG - Intergenic
994869437 5:105327607-105327629 GGCCACAAGCAGGCCAGGCGCGG + Intergenic
997466771 5:134093487-134093509 GGGGACAGCCTGCCCTGGCCTGG - Intergenic
997648644 5:135498602-135498624 GGCCTCAGGATGCCAAGGCCTGG - Intergenic
997697147 5:135870609-135870631 GGGCACAGCCTGGCCAGGGCTGG + Intronic
999261234 5:150240112-150240134 GGACAAAGGGTGCTCAGGCCTGG + Intronic
999283401 5:150379632-150379654 GGCCTTCGGCTGCCCAGGCAGGG + Exonic
999327081 5:150650154-150650176 GGCTGCAGGCTGTCCTGGCCGGG - Exonic
999637019 5:153633575-153633597 GAGCACATGCTGCCCAGCCCAGG - Intronic
999709225 5:154301786-154301808 GTCCACAGGCTCCCCCAGCCTGG + Intronic
999782003 5:154857584-154857606 GGCCACACGCTGCCCAGGGCCGG + Intronic
1001409168 5:171498055-171498077 GGCCCCAGGCTCACCACGCCTGG - Intergenic
1001470282 5:172006935-172006957 AGCCCAAGGCTGCCCAGACCGGG + Intergenic
1001688381 5:173613538-173613560 GGCTGCAGGCTGCCCAGGTGTGG - Intronic
1001980697 5:176035510-176035532 GGCCACAGGCAGCACAGCCCTGG + Intergenic
1002098843 5:176847398-176847420 GGGAACAGGCTGCCGAGGCGGGG + Intronic
1002236764 5:177808555-177808577 GGCCACAGGCAGCACAGCCCTGG - Intergenic
1002512687 5:179733089-179733111 GGCCGCGGGCTGCACGGGCCGGG - Exonic
1003098575 6:3160003-3160025 GGGCACATGCTCCACAGGCCGGG - Intergenic
1003406554 6:5831355-5831377 GGCCCCATGCTGCCCAGTCCTGG + Intergenic
1003621955 6:7708298-7708320 GGCCACATGCGGCCCAGGACAGG + Intergenic
1005495536 6:26384740-26384762 GGGCACAGGGTGCCCAGGGCGGG + Intronic
1005834928 6:29701972-29701994 GACCATAGGCTGCTCAGGGCTGG + Intergenic
1005963960 6:30713313-30713335 GGCCCAAGGCCGCCCAGGACCGG + Exonic
1006002454 6:30976087-30976109 TCCCACAGGCTGCCAAGTCCAGG + Intergenic
1006631370 6:35432456-35432478 GGACACAGGCTGCCCTGAGCAGG - Intergenic
1006694505 6:35920363-35920385 AGCCACAGGGTGCCCAAACCCGG + Intronic
1006915392 6:37590800-37590822 GGCCAGCGGTGGCCCAGGCCAGG - Intergenic
1006996190 6:38263679-38263701 GACCACAGGCTGTGCAGTCCAGG + Intronic
1007112758 6:39322527-39322549 GGCCACAGCATGCCCAGTGCTGG - Exonic
1007728038 6:43928632-43928654 CTCCACAGGCTCCCCAAGCCTGG + Intergenic
1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG + Intergenic
1008921017 6:56843928-56843950 GGACACTGGCTGCCCGGTCCCGG + Intronic
1008981509 6:57489079-57489101 GGCCACAGGCTGCACATGAGTGG + Intronic
1009169601 6:60382108-60382130 GGCCACAGGCTGCACATGAGTGG + Intergenic
1016893729 6:149032540-149032562 GGACACAGGCAGCTCATGCCTGG - Intronic
1017103169 6:150865974-150865996 GGCCGCAGGATGGCCAGGCCCGG + Exonic
1017619068 6:156276202-156276224 TGCCACATGCTGCCCAATCCTGG + Intergenic
1017905115 6:158752718-158752740 GACCTCTGGCTGCCCAGCCCCGG - Intronic
1018071480 6:160167909-160167931 GGGCACAGGCTGCCCAAGGAGGG + Intergenic
1019301442 7:306054-306076 GGCCAGAGGGTGCCCAGGGCCGG - Intergenic
1019421439 7:953072-953094 GGCCACAGCAACCCCAGGCCAGG + Intronic
1019903692 7:4044245-4044267 GGCTGCAGGCTGGCGAGGCCAGG - Intronic
1019972689 7:4554245-4554267 GGCCATGGGGTGCCCAGGCTAGG - Intergenic
1020002831 7:4765421-4765443 GGTCACAGGCCGCCCAGGCTGGG - Exonic
1023019401 7:35996982-35997004 GGCCTCAGGCCGCCCAGGCTTGG - Intergenic
1023028670 7:36074482-36074504 TGCCACAGGCTGACAGGGCCTGG - Intergenic
1023059755 7:36315972-36315994 GGCCCCAGGGTGCCTAGGACAGG - Intergenic
1023812938 7:43926482-43926504 CGCCTCAGGCAGCCCCGGCCGGG + Exonic
1023817545 7:43962090-43962112 GGTCACAGGCTGCCCATTCCAGG - Intergenic
1024085251 7:45887434-45887456 GACAACAGGAGGCCCAGGCCTGG + Intergenic
1024281883 7:47725245-47725267 GGCCAGGAGCTGGCCAGGCCAGG + Intronic
1024579310 7:50788871-50788893 TGCCACAGGCTCCACAGGCCTGG + Intronic
1024633199 7:51265701-51265723 AGGCACAGGCTGCCCTGGCAGGG - Intronic
1025976863 7:66377045-66377067 GGCCGCGGCCTCCCCAGGCCAGG - Intronic
1026459968 7:70605361-70605383 GTTCACAGGCTGACCAAGCCAGG + Intronic
1026902627 7:74045417-74045439 AGCACCAGGCTGCCCAGGGCTGG - Intronic
1027134106 7:75612058-75612080 GCCCTCGGGCTGCCAAGGCCAGG + Intronic
1027857208 7:83527135-83527157 AGCCACAGAATGCCCAGGACTGG + Intronic
1028717066 7:93983068-93983090 GACCAGAGGTGGCCCAGGCCAGG + Intronic
1028984110 7:96996687-96996709 GGTCCCAGGCAGCCCCGGCCGGG + Intergenic
1029111732 7:98216194-98216216 GGCGAGAGGCTGGCCCGGCCCGG - Exonic
1029330404 7:99848860-99848882 GTCCCCAGTCTGCCCAGGACAGG - Intronic
1029460899 7:100693683-100693705 GCCCCCAGGCGGCCCAGGGCAGG + Intergenic
1029742170 7:102496964-102496986 GGTCACAGGCTGCCCATTCCAGG - Exonic
1029760159 7:102596129-102596151 GGTCACAGGCTGCCCATTCCAGG - Exonic
1031990666 7:128196916-128196938 GGTCACAGCCTGCACAGGACTGG - Intergenic
1032016808 7:128385343-128385365 AGCCACACGCCGCACAGGCCAGG + Intergenic
1032499120 7:132386553-132386575 GGGAACAGGCTGCCCAGGCTTGG + Intronic
1032978316 7:137251350-137251372 GGTCACATTCTCCCCAGGCCTGG + Exonic
1034227927 7:149497451-149497473 GGCCCCAGGCGGCCCGGCCCCGG - Intronic
1034291361 7:149934697-149934719 GGCCACAGGCTGGTCAGTGCGGG + Intergenic
1034393264 7:150801672-150801694 GGCCCCGGGCCACCCAGGCCAGG + Exonic
1034401146 7:150862491-150862513 GGCCACGGGCTGGCCAGGTAGGG + Intergenic
1034814737 7:154162197-154162219 GGCCACAGGCTGGTCAGTGCGGG - Intronic
1035035118 7:155889796-155889818 TGAAACAGGCTGCCCAGGGCTGG + Intergenic
1035045288 7:155961750-155961772 GGCCAGAGCCAGCCCAGGGCTGG + Intergenic
1035099544 7:156384865-156384887 GGCCGCAGTCAGCCCAGGCGTGG - Intergenic
1035173435 7:157033609-157033631 GGCCACAGGAAGCCCCGCCCTGG - Intergenic
1035429991 7:158812133-158812155 GGGCACAGGCTGCCCTCTCCAGG - Intronic
1036651874 8:10649478-10649500 GACCACAGCCTGCCCCAGCCAGG + Intronic
1036688437 8:10926598-10926620 GGCACCAGGCCCCCCAGGCCAGG + Intronic
1037458191 8:19084046-19084068 AGCCGCAGCCTTCCCAGGCCTGG - Intronic
1037898430 8:22673669-22673691 GGCCAAGGGCTGTCCAGGCTGGG + Intergenic
1038433444 8:27518444-27518466 GGTCACAGTCTGCACAGGTCTGG - Intronic
1038433672 8:27519847-27519869 GGTCACAGTCTGCACAGGTCTGG + Intronic
1039445235 8:37625879-37625901 GCCCACAGGCAGGCCAGTCCTGG + Intergenic
1039613513 8:38937312-38937334 GGCCTCTGGCTGCTCTGGCCCGG - Intronic
1039760650 8:40570822-40570844 GGCCATCTGCTTCCCAGGCCAGG + Intronic
1040337448 8:46423251-46423273 GGCCACAGGGTGGCGAGGGCAGG + Intergenic
1040338843 8:46429767-46429789 GGCCGCAGGGTGGCCAGGGCGGG + Intergenic
1040471368 8:47738052-47738074 GGGCGCAGGCTCCGCAGGCCAGG + Exonic
1041200824 8:55451137-55451159 GGCCACAGGAAGCCCGGGTCGGG + Intronic
1041673763 8:60517422-60517444 GGCCGCGGCCTGGCCAGGCCCGG + Intronic
1042880133 8:73478393-73478415 GGCCACATGCAGCCCAGGACAGG - Intronic
1045051722 8:98333605-98333627 GGCCACAGGATGCTCAGACTGGG + Intergenic
1046879352 8:119291113-119291135 GGCCACATGCTGCCCAGCCTGGG + Intergenic
1047795270 8:128248770-128248792 GTCCAAAGGCTGCCAAGGGCTGG - Intergenic
1049199022 8:141330955-141330977 CACCACAGGCTGCCCAGGTGGGG - Intergenic
1049377691 8:142296799-142296821 CCCCACAGGCTCCCCAGGACGGG + Intronic
1049409329 8:142465385-142465407 GGCCAGAGGCTGCAGCGGCCTGG + Intronic
1049446838 8:142635120-142635142 GCCCACTGGCTGCCCGGGGCTGG + Intergenic
1049501766 8:142971088-142971110 AGGCACTGCCTGCCCAGGCCTGG + Intergenic
1049523139 8:143105114-143105136 TGACATAAGCTGCCCAGGCCAGG + Intergenic
1049591353 8:143464412-143464434 GGCCAAGGGTTGGCCAGGCCGGG - Intronic
1049598171 8:143494157-143494179 CCCCACAGGCTGACCACGCCTGG + Intronic
1049662691 8:143827213-143827235 GGCCCCCGGCTGCCATGGCCTGG - Intronic
1049745607 8:144261970-144261992 GGCCAGAGGGTGCCCTGGACTGG + Intergenic
1049809099 8:144555320-144555342 GGCTCCAGGCTGCCTAAGCCAGG + Intronic
1050890572 9:10819376-10819398 GGACACAGGGTGCCTAGTCCTGG + Intergenic
1051107703 9:13598902-13598924 AGCCACAGGCTGCCAAAGTCTGG - Intergenic
1051740696 9:20248964-20248986 GACCACAGCCTGCACAGGCCAGG + Intergenic
1052989231 9:34509085-34509107 AGCCACAGACTGACCAGGGCAGG + Intronic
1053283433 9:36836056-36836078 AGCCACTGGCTGCCAAGGCTGGG + Exonic
1053352833 9:37424732-37424754 GGCCTCAGGCTGCCCGGGGCTGG - Intronic
1053415558 9:37944936-37944958 AGACACAGGCTGGCCTGGCCAGG + Intronic
1053611267 9:39715471-39715493 GGCTACAGGTTGTCCAGGCGAGG - Intergenic
1054086987 9:60755689-60755711 GGCTACAGGTTGTCCAGGCGAGG + Intergenic
1054242253 9:62626921-62626943 GGCTACAGGTTGTCCAGGCGAGG + Intergenic
1054556378 9:66661437-66661459 GGCTACAGGTTGTCCAGGCGAGG + Intergenic
1056271829 9:84954732-84954754 GGCCGCAGGCTGCCCAGCTCTGG + Intronic
1057045802 9:91885486-91885508 AGCCACACGCTGCTCAGTCCTGG - Intronic
1057047528 9:91897790-91897812 TTCCAAAGGCAGCCCAGGCCCGG + Intronic
1057199670 9:93133500-93133522 GCCCACAGCCCTCCCAGGCCGGG + Intronic
1057315597 9:93966466-93966488 GGCCACATTCTGGCCAGCCCTGG + Intergenic
1057489177 9:95508480-95508502 GGCCGCAGGCTGCTCGGGCTCGG + Exonic
1057546528 9:96023006-96023028 GGACAAAGGCAGCCCAGACCTGG - Intergenic
1057550873 9:96050117-96050139 GGCCTCACGCTGCCCAGGGTAGG - Intergenic
1057951390 9:99371533-99371555 GGCCCCAGGCGGCCCTGTCCTGG + Intergenic
1059321887 9:113476488-113476510 GACTCCAGGCTCCCCAGGCCAGG - Intronic
1060265433 9:122109143-122109165 GGCCACTGGCTTCCTGGGCCTGG + Intergenic
1060268490 9:122125951-122125973 GCCCCCAGGCTGGTCAGGCCCGG + Intergenic
1060660760 9:125404004-125404026 GGCTAGAGGCTTCCCAGGCAGGG - Intergenic
1060820573 9:126659273-126659295 GGACACGTTCTGCCCAGGCCTGG - Intronic
1060926866 9:127461319-127461341 ATCCACAGGCTGCCCCGCCCGGG + Intronic
1061005450 9:127926626-127926648 GGCCACTGGTGGCCCAGCCCAGG + Intronic
1061163131 9:128907371-128907393 GGCCAGGGGCTGCCCAGCCCCGG - Exonic
1061566436 9:131443892-131443914 GGCCACAGCCTGCCCCAGCAGGG - Intronic
1062113926 9:134797386-134797408 GGCCACTGGGTGCCAAGGACTGG - Intronic
1062136762 9:134933222-134933244 GCCCAGTGGCAGCCCAGGCCAGG + Intergenic
1062173612 9:135148814-135148836 GACCACAGGGTGGCCAGGGCAGG + Intergenic
1062184893 9:135212973-135212995 GGTCAAGGTCTGCCCAGGCCTGG - Intergenic
1062268568 9:135698674-135698696 GGCGACAGGCTGTCCAGCCCAGG + Intronic
1062313033 9:135949729-135949751 GGCCGCACGCTCCCCGGGCCTGG + Intronic
1062364024 9:136200430-136200452 GGCCACAGGGTGCCCTGCCTGGG + Intronic
1062405829 9:136395821-136395843 GGCGACTGGCTGCCGAGGACAGG - Intronic
1062437421 9:136552725-136552747 GGCCAGAGGCTGCCCTGGGATGG + Intergenic
1062442282 9:136576193-136576215 GGCCCCAGGCTGGGCAGGCTGGG - Intergenic
1062465564 9:136679399-136679421 GGCCCCAGGCTTCCAAGTCCAGG - Intronic
1062499348 9:136845608-136845630 GGCCCCAGTCCGCCCAGGCCGGG - Exonic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062540019 9:137037428-137037450 GGCCACAGCCCACCCAGACCAGG - Exonic
1062689338 9:137833404-137833426 GGCCTCGGGCTGCACAGGCAGGG + Intronic
1203474911 Un_GL000220v1:142464-142486 GGCCAGAATCTGCCAAGGCCCGG - Intergenic
1186660486 X:11664381-11664403 GGCTACTGGCTGGCCCGGCCAGG + Exonic
1187122900 X:16426459-16426481 GTCCACAGGCTGCTGAGGCTTGG - Intergenic
1187543363 X:20221964-20221986 GCCCTTAGGCTGGCCAGGCCTGG - Intronic
1187902121 X:24035025-24035047 GCTCTGAGGCTGCCCAGGCCGGG - Intergenic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1190064894 X:47233140-47233162 CGCCACTGGCTGTCCAGGCCTGG - Exonic
1190274540 X:48891598-48891620 GTCCAGAGGCTGCCGAGGGCGGG + Intergenic
1192151489 X:68715392-68715414 GGCCTTTGGCTTCCCAGGCCTGG - Intronic
1198266925 X:135018160-135018182 GCTCACAGGCTGACCAGTCCTGG + Intergenic
1199392034 X:147291313-147291335 GGCCAGAGGATGCCCAAGTCAGG - Intergenic
1199392059 X:147291715-147291737 GGCCAGAGGATGCCCAAGTCAGG + Intergenic
1199902434 X:152189652-152189674 GGCTATAGGCTGCCCACTCCTGG + Intronic
1200064835 X:153499386-153499408 CGCCACAGGCTGCAAAGGGCTGG + Intronic
1200076835 X:153555333-153555355 CGCCGCAGGCTCCCCAGGCCTGG + Intronic
1200101107 X:153689343-153689365 GGCCGCAGGCTTCCCAAGCCTGG - Intronic
1200242918 X:154507157-154507179 GGCGACAGGCTGCCCCGGTGGGG + Intronic
1200273758 X:154712521-154712543 GGCCTCAGGCTGCCCTGATCTGG - Exonic