ID: 907526480

View in Genome Browser
Species Human (GRCh38)
Location 1:55056869-55056891
Sequence GCGCGCGCGCGCGTTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907526475_907526480 16 Left 907526475 1:55056830-55056852 CCACTTCAAGTCTGGAACTTCAA 0: 1
1: 0
2: 0
3: 7
4: 150
Right 907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG 0: 1
1: 0
2: 6
3: 56
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907526480 Original CRISPR GCGCGCGCGCGCGTTGGGGG TGG Intronic
900092187 1:925322-925344 GTGCGAGCGCGCGGCGGGGGAGG + Intronic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
901242868 1:7704958-7704980 GGGCGCGCGCGGGGCGGGGGCGG + Intronic
901433883 1:9234724-9234746 GGGGGCGCGCGCGGCGGGGGCGG - Intergenic
901443878 1:9295240-9295262 GTGCGCGCGTGCGGTTGGGGAGG + Intronic
901762659 1:11480658-11480680 GTGCACGCGCGCGCTGGGGGTGG - Intronic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
903016620 1:20366074-20366096 GCGCGCGCAGGGGTTGGGGAGGG - Intergenic
903043948 1:20552434-20552456 GCGCGAGCCTGCGTGGGGGGAGG + Exonic
903349867 1:22711058-22711080 GGGCGGGCGGGCGATGGGGGCGG + Intronic
904181351 1:28668862-28668884 GCGCGGGCGCGGGGTGGGGTGGG + Intronic
904181381 1:28668927-28668949 GCGGGCGGGCGCGCAGGGGGCGG + Intronic
904517254 1:31065896-31065918 GCGCGCGCTCGCCTAGCGGGCGG - Intronic
904941252 1:34166003-34166025 GTGTGCACGCGAGTTGGGGGTGG + Intergenic
906640456 1:47438023-47438045 GCGCGCGGGCGGGGAGGGGGCGG - Exonic
907160633 1:52366285-52366307 GCGCGCAGGCGCGTTCGGGTAGG + Intergenic
907278145 1:53328139-53328161 GGGAGCGCGCGCGCTGGCGGCGG - Intergenic
907351797 1:53838121-53838143 TCGCGCGTGCGCGCTGGGCGGGG - Intronic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
910694213 1:89995016-89995038 GCGGGCCCTCGCGTGGGGGGCGG - Intergenic
912416238 1:109509766-109509788 GCGCGTGCGCGCGGCGGGGGCGG + Intergenic
912556457 1:110519740-110519762 GTGCGCGCGCACGCTGGAGGTGG + Intergenic
912717083 1:111990239-111990261 GCGCGCGCGTGAGCGGGGGGTGG + Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
915326142 1:155082141-155082163 GCGCGCCCGGGCTTTGAGGGTGG - Intronic
915722090 1:157993226-157993248 GTGTGTGCGCGCGTTGTGGGGGG + Intergenic
918048344 1:180954403-180954425 GTGCGCGCGTGTGCTGGGGGCGG - Intergenic
919451190 1:197775106-197775128 GGGCCCGGGCGCGTCGGGGGCGG - Intronic
919712078 1:200738840-200738862 GCGGGGGCGGGGGTTGGGGGGGG + Intergenic
920409768 1:205750019-205750041 CCGAGCGCGCGGGGTGGGGGGGG - Exonic
920922639 1:210311133-210311155 GCGCGCGCACGTGGCGGGGGGGG - Intergenic
920922641 1:210311135-210311157 GTGCGCGCGCACGTGGCGGGGGG - Intergenic
921603981 1:217135518-217135540 GGGCGCGCGCGCGGCGGCGGCGG + Intronic
922196500 1:223364234-223364256 GAGCGGGCGGGTGTTGGGGGAGG + Intergenic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
923171678 1:231422333-231422355 GCGCGCGAGGGCGGAGGGGGCGG + Exonic
923372731 1:233328678-233328700 GGGCGCGCGCGGGTCCGGGGCGG - Exonic
923490474 1:234479181-234479203 GCGCACGCGCACGTAGGGGCCGG - Intergenic
923506790 1:234611157-234611179 GCGAGGGCGCGAGTGGGGGGGGG + Intergenic
923783232 1:237043301-237043323 GCGCGCGCGCGGGTGGTGGTGGG + Intronic
1062843862 10:689920-689942 GCGCGCGCGCGCGGGGCGCGAGG + Intergenic
1063624804 10:7679005-7679027 GTGCGCGCGCGCGCGGAGGGAGG - Intergenic
1067474378 10:46556461-46556483 CCGCGCGCTCCCGTTGGGGCGGG - Intergenic
1067669613 10:48306941-48306963 GCGGGAGCGCGCGGTGGGCGGGG + Intronic
1071676367 10:87659682-87659704 GCGCGCCCGCGAGTAGGGGCCGG + Intronic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1072283728 10:93893893-93893915 GCGCGCGGTCTCCTTGGGGGAGG + Intergenic
1072926463 10:99620874-99620896 GCGCGGGATCGCGTCGGGGGCGG + Intergenic
1074088628 10:110226943-110226965 GGGAGCGCGCGCGTGAGGGGAGG + Intronic
1074618379 10:115093132-115093154 GCGCGCGCGAGGGCGGGGGGCGG + Intergenic
1076900767 10:133336366-133336388 GCCCGCACGGGGGTTGGGGGTGG - Intronic
1077040444 11:518835-518857 CCTCGCTCGCGCGTTCGGGGCGG - Intergenic
1079291132 11:19188654-19188676 GTGGGCGCGCGCGTTGGCAGGGG + Intronic
1080551394 11:33376369-33376391 GCGCGCCGGCGCGATTGGGGCGG - Intergenic
1081528277 11:43942076-43942098 GCGCGCGCGCGCCTGCGGAGGGG + Intronic
1081863534 11:46347546-46347568 GCGAGCGCGCGCCATGGAGGTGG + Intronic
1082007322 11:47426553-47426575 GCCGACACGCGCGTTGGGGGCGG + Intergenic
1082035552 11:47642563-47642585 GCGTGCGCGCGCGCCGCGGGCGG - Exonic
1083227515 11:61294425-61294447 GCGTGTGCGCGCGTGGGGGTGGG - Intronic
1083753614 11:64777794-64777816 GTGCGCACGCGCGCTGTGGGGGG - Intronic
1083753636 11:64777867-64777889 GCGCGCGTGCGCGCACGGGGAGG - Intronic
1083861398 11:65422229-65422251 GCCCGGGCGCGGGTTGGGGGCGG - Intergenic
1084265727 11:68004199-68004221 GCGCGCGCGCGCGTGTGTGCAGG + Intronic
1084588730 11:70078403-70078425 GCCCGCGCGCTCGATGCGGGGGG - Exonic
1085165899 11:74398761-74398783 GGGCACGCGCCGGTTGGGGGAGG + Intergenic
1088566743 11:111180600-111180622 GCGCGCACGCGTGTGGTGGGGGG - Intergenic
1091023856 11:132124623-132124645 GCGCGCGCACGCGCAGGGCGGGG + Intronic
1093547842 12:20369211-20369233 GCGCGCGCGCGCGTGGGTCGGGG + Intergenic
1093547844 12:20369215-20369237 GCGCGCGCGTGGGTCGGGGCGGG + Intergenic
1093958694 12:25250611-25250633 GCGCGGGCGCGGGGTCGGGGCGG - Intronic
1094218509 12:27970347-27970369 GCGGGCGGGCGCGCGGGGGGCGG + Intronic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096642734 12:53006970-53006992 ACGCGAGCGCGAGTTGGTGGAGG + Intronic
1096710632 12:53452629-53452651 GGGCGCGCGCGCGGTAGGGGGGG + Intronic
1096994614 12:55830808-55830830 GCGCGCGTGCGCGCGGTGGGGGG - Intronic
1101504150 12:105330911-105330933 GCCCGCGCCCGCGCTGGTGGCGG - Exonic
1103308988 12:119989624-119989646 GCGCGCGCGGGAGGAGGGGGTGG - Intergenic
1103698446 12:122835318-122835340 GCGCGCCCTGGAGTTGGGGGCGG + Intronic
1104568420 12:129904361-129904383 GCGCGGACGCGCGGTGGCGGCGG + Intergenic
1104919700 12:132284291-132284313 GCGTGCGCGCGCGTTGTGTGCGG - Intronic
1105472504 13:20705304-20705326 GCGAGCGGGGGCGGTGGGGGTGG + Intronic
1106109041 13:26760828-26760850 GGGCGCGCGCGGGGCGGGGGCGG - Intergenic
1106735672 13:32586294-32586316 GTGCGCGCGCGCGGACGGGGCGG + Intergenic
1107467546 13:40664822-40664844 GCGGGCGCGGGCGGTGGCGGTGG - Intronic
1108541665 13:51452267-51452289 GCCCGCCCGCGCGGTGGGGGAGG + Intronic
1111183990 13:84705235-84705257 GCGCGCGCGCGCGTGCGTGTTGG + Intergenic
1112503599 13:99959921-99959943 GCGCACGGGCGTGTTGGGGTCGG - Intergenic
1113517384 13:110914367-110914389 GCGCGCGCGCGCGGATGGTGCGG - Intronic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1113820371 13:113209027-113209049 GCGCGCGCCCGAGGAGGGGGAGG + Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118323160 14:64765046-64765068 GCGCGCGCGCGGGTGGTGGATGG + Intronic
1119046398 14:71321370-71321392 GCGTGCGCGCGCGCCGGGCGCGG - Intronic
1120881057 14:89416116-89416138 GCGCGCGCGCGCGTGCTGGGTGG - Intronic
1121074885 14:91060143-91060165 GTGGGGGCGCGCCTTGGGGGAGG - Intronic
1121439333 14:93939032-93939054 ACGCGCGCGCGCATGGGAGGCGG - Intronic
1122582076 14:102777378-102777400 ACGCGCGCGGGCGGCGGGGGCGG + Intergenic
1123001999 14:105300803-105300825 GCGGGCGCGGCCGTTGCGGGCGG - Exonic
1124109529 15:26773152-26773174 GCGCGCGCGGGCGCGGGGCGGGG + Intronic
1124109531 15:26773156-26773178 GCGCGGGCGCGGGGCGGGGGAGG + Intronic
1125270537 15:37934103-37934125 GCGCGCGCGCGCGTGTGTGTAGG - Intronic
1125805628 15:42491116-42491138 GTGCGCCTGCGCGTTGGCGGCGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127439095 15:58988107-58988129 GCGCGTGCGCGCAACGGGGGAGG + Intronic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1128582730 15:68820385-68820407 GCGGGCGCACGCGTTTGGGTCGG - Intronic
1128791136 15:70434705-70434727 GCGCGCGCGCGGGTGGAGCGGGG - Intergenic
1128791138 15:70434707-70434729 GCGCGCGCGCGCGGGTGGAGCGG - Intergenic
1130224410 15:82046309-82046331 GCGAGCGCGGGGGTGGGGGGTGG - Intergenic
1135821720 16:25691882-25691904 GCGCGCGCCTGCGAAGGGGGCGG - Intergenic
1136399871 16:30011441-30011463 GCGCGCGCGGGCGGGGGCGGGGG - Intronic
1136540008 16:30923814-30923836 GGGTGCGCGCGGGCTGGGGGGGG + Intronic
1136579467 16:31142911-31142933 GCGCCCGCGCGCGGAGCGGGTGG - Exonic
1137531725 16:49282299-49282321 GTGGGCGCGCCCGTTGGGAGGGG + Intergenic
1137531762 16:49282407-49282429 GCGTGCGCGCGCGGCGGGGCGGG + Intergenic
1139473740 16:67192215-67192237 GCGGGCGGGCGCGATGGCGGAGG + Exonic
1139615350 16:68085332-68085354 GGGTGGGCGCGCGTAGGGGGCGG + Intronic
1139754656 16:69132624-69132646 GCGCGCGCGCACGTGGGGCCGGG + Exonic
1142582596 17:951563-951585 GCGGGGGCGGGGGTTGGGGGCGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143183488 17:4997900-4997922 GCGAGCGCGCGCGGAGGGGCGGG - Intergenic
1143490098 17:7281292-7281314 GCCGGCGCGCGGGTTGGGAGAGG - Intergenic
1144172833 17:12676226-12676248 GTGCGTGCGCGCGCAGGGGGAGG - Intronic
1144816595 17:18039593-18039615 GCGCACGCGCGGGGTGGGGGCGG - Exonic
1145197641 17:20908662-20908684 GCGCGCCTGCGCGTGGGGGGGGG - Intergenic
1146439045 17:32877289-32877311 GCGCACGCGCGGGTGGGCGGCGG + Intergenic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1147969157 17:44210506-44210528 GAGCGCGCGCCCCCTGGGGGTGG - Intronic
1147990005 17:44326802-44326824 GCACGCGCGGGCGGTGGCGGAGG + Intergenic
1148284092 17:46372782-46372804 GGGCGCGCGCGCGGCGGGGGCGG + Intergenic
1148306313 17:46590703-46590725 GGGCGCGCGCGCGGCGGGGGCGG + Exonic
1148591057 17:48817089-48817111 GGGCGAGCGCGGGTTGGGGTTGG - Exonic
1148936332 17:51166722-51166744 GCGGCCGCGCGTGGTGGGGGAGG + Exonic
1149038516 17:52159592-52159614 GTGCGCGCGCGGGTTTGGTGGGG - Intronic
1149454991 17:56780530-56780552 GCGCGTGCTTGCGTTGGGGCGGG - Intergenic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1151708401 17:75785000-75785022 GCGTGCGCGCGCGGCGGGGGGGG - Intronic
1152628851 17:81400579-81400601 GCGCGGGCGCGGGCTGGGGGTGG + Intronic
1152689658 17:81712263-81712285 GCGCGCGCGCGCCCCGGGGGCGG - Intronic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1152721890 17:81927487-81927509 GCGGGCCCGGGCGGTGGGGGCGG - Intronic
1156000355 18:32378058-32378080 GCGCGCGGGCGCTTTGGAGGAGG + Intronic
1157464257 18:47930675-47930697 GCGGGCGCGCGCCTGAGGGGAGG - Intronic
1159346728 18:67215840-67215862 GGGCGCGCGCGGGTTCCGGGTGG - Intergenic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160500712 18:79400125-79400147 TCGCGCGCGCGCGAGGGGGCGGG + Intronic
1160500714 18:79400127-79400149 GCGCGCGCGCGAGGGGGCGGGGG + Intronic
1160909003 19:1466252-1466274 GCGCACGCGGGCGTCGGCGGAGG - Exonic
1160937817 19:1605482-1605504 GCGCACGCGCGCGGGGAGGGCGG + Exonic
1160947940 19:1652206-1652228 CCGCGCGCGCTTGTTGGGGGGGG - Intronic
1161401598 19:4067972-4067994 GCGACCGCGCGCCTGGGGGGGGG + Intergenic
1161643070 19:5436362-5436384 GCGCGCGCGCGCGTGCGGGGAGG + Intergenic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1161664641 19:5568003-5568025 GAGCGCGGGCGCGGCGGGGGCGG - Intergenic
1161802583 19:6424400-6424422 TCGCGCGCGCGCGCAGGCGGGGG - Intronic
1161959460 19:7515968-7515990 GCGCGGCCGCGCGGTCGGGGTGG + Intronic
1162095662 19:8308351-8308373 GCGCACGCGCGGGGTTGGGGCGG + Exonic
1162485964 19:10960853-10960875 GCGCGCACGCGCGCCGGGAGCGG + Intergenic
1162586043 19:11559149-11559171 GTGCGAGTGGGCGTTGGGGGTGG - Intronic
1162742688 19:12782649-12782671 GTGCGCGCGTGCGTGGGCGGTGG + Intronic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1165888970 19:39099215-39099237 GGGGGCGCGCGGGTCGGGGGCGG + Intronic
1166361305 19:42253996-42254018 GCGCCCGAGCGCGCAGGGGGAGG - Intronic
1167001201 19:46746511-46746533 GGGCGCGCGCGCGGTGGTTGCGG - Exonic
1167072771 19:47230534-47230556 GGGCGCGCGCCCGCTGGGGGCGG - Intronic
1167072778 19:47230543-47230565 GCGGGCGCGCGCCCTGGGTGTGG + Intronic
1168110543 19:54189411-54189433 GCGCGGGGGCGCGCTGGGCGGGG - Exonic
1168227244 19:55004589-55004611 GTGTGTGTGCGCGTTGGGGGAGG - Intergenic
1168408073 19:56121032-56121054 GCGCGCGTGCGCGCTGCTGGGGG - Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
927652441 2:24920459-24920481 GCGGGCGCGGGCGTGGGCGGTGG + Intergenic
927692227 2:25216204-25216226 GCGCGCGCATGCGTTGGGGCGGG + Intergenic
928278300 2:29921621-29921643 GCGCGAGCGCGCGCAGGGAGGGG + Intergenic
929033714 2:37671807-37671829 CCGGGCGCGCGCGCGGGGGGGGG + Exonic
929313284 2:40450370-40450392 GCACGCGCGCGCGCTGGTGGGGG + Intronic
929511545 2:42568948-42568970 TCGCGAGCCCGCGTGGGGGGAGG - Intronic
929918317 2:46154458-46154480 GCGGGCGGGGGGGTTGGGGGGGG - Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
931348970 2:61471282-61471304 GGGCGAGCGCGCGGAGGGGGTGG - Intergenic
931763761 2:65436929-65436951 GTGTGTGCGCGCGTTGGGGAGGG + Intergenic
931869059 2:66440040-66440062 GCGCGCGCGCGCGTGTGTGTTGG - Intronic
932496668 2:72148991-72149013 GTGAGCGCGCGGGTTGGGGCGGG - Intergenic
934966808 2:98730961-98730983 GAGGGCGCGGGAGTTGGGGGCGG - Intronic
936954744 2:118013341-118013363 GCGCGCCGGGGCGTTCGGGGTGG - Intronic
938258350 2:129877754-129877776 GGGCGGGCGCGCGTGTGGGGGGG + Intergenic
938258357 2:129877776-129877798 GCGGGCGCGCGTGTCGGGGGCGG + Intergenic
938258364 2:129877793-129877815 GGGCGGGCGCGCGTGTGGGGGGG + Intergenic
939153803 2:138501753-138501775 GCGCGTGCGCGCGGCGGCGGCGG - Intergenic
940854206 2:158717151-158717173 GTGCTAGCGCGCGGTGGGGGTGG - Intergenic
943333898 2:186590557-186590579 GTGGGTGCGCGCGGTGGGGGAGG - Intronic
943589911 2:189784479-189784501 GCGCGCGTGCGTGCTGGGTGCGG + Exonic
947119238 2:226799131-226799153 GCGCGCGCGCGCGCTCCTGGAGG - Exonic
947958972 2:234218682-234218704 GTGTGCGCGCGTGTTTGGGGTGG + Intergenic
948910302 2:240999232-240999254 GCGCGCGGGCGGGGCGGGGGCGG + Intronic
1168855084 20:1002400-1002422 GAGCGCGCGCGGGGAGGGGGCGG + Intergenic
1169164114 20:3407683-3407705 GCGCGCGGGCCCGGCGGGGGCGG + Intergenic
1170934378 20:20796955-20796977 GCGTGCGCCGGCGCTGGGGGTGG + Intergenic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1171823164 20:29874071-29874093 GCGAGCGGGCGCGTTCAGGGTGG - Intergenic
1173548126 20:43914736-43914758 GCGCGCGGGCGGGGCGGGGGCGG + Intergenic
1174467867 20:50731432-50731454 GCGCGCGCGCGGGCTCGCGGGGG + Intergenic
1174607102 20:51768690-51768712 GCGCGGGCGCGGGCCGGGGGCGG - Intergenic
1175911500 20:62407308-62407330 GCGGGCGCGCGGGCAGGGGGTGG - Intergenic
1176178539 20:63739524-63739546 GCGCGGGCGCGCGAGGTGGGCGG + Intronic
1176194569 20:63831293-63831315 GCGCGCGCGCGCGGGCGGCGGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176207177 20:63895383-63895405 GGGCGGGCGCGGGTGGGGGGCGG + Intronic
1176311843 21:5154755-5154777 CCGGGCGCGCGCGCTGTGGGCGG - Intergenic
1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176569036 21:8400268-8400290 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176576950 21:8444503-8444525 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176952651 21:15064896-15064918 GGGCGCGCGCGGGTGGCGGGCGG + Exonic
1179845206 21:44107280-44107302 CCGGGCGCGCGCGCTGTGGGCGG + Exonic
1180014670 21:45074506-45074528 GCGCGCGCACGCCGAGGGGGCGG - Intronic
1180256867 21:46635659-46635681 GCGCTTGCGCGGGTTGAGGGCGG + Exonic
1181094324 22:20495534-20495556 GGGCGCGGGCGCGTAGGGGCCGG - Intronic
1181514388 22:23402721-23402743 GAGCGCGGGCGCGAGGGGGGCGG + Intergenic
1181831647 22:25564909-25564931 GCGGGGGCGCGCGGAGGGGGGGG + Exonic
1182149512 22:28018295-28018317 GTGTGCGCGCGCGGGGGGGGGGG + Intronic
1182321549 22:29481150-29481172 GCAGGCGCGCGGGTGGGGGGAGG + Intronic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1182638755 22:31750193-31750215 GCGCGCGCGCGGTGCGGGGGCGG - Intergenic
1184680781 22:46071328-46071350 GCGCGCGCGGGCGGGGCGGGCGG - Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
950345319 3:12287838-12287860 GCGCGGGCGCCGGCTGGGGGTGG - Intronic
950562900 3:13745825-13745847 GCGTGCGTGCGCCTAGGGGGAGG + Intergenic
951544481 3:23810795-23810817 GGGCGCGCGCGGGGTGGGGGCGG + Intronic
952970937 3:38649714-38649736 GCGCGGGCTCGGGCTGGGGGCGG + Intergenic
953881617 3:46693946-46693968 GCGCGTGGGTGCGTAGGGGGCGG - Intergenic
955663262 3:61323985-61324007 GTGTGTGCGCGCGTTGGGGAGGG + Intergenic
955911744 3:63864415-63864437 GCGCCCACGCGCGCTGGGGCGGG + Intergenic
956681448 3:71785252-71785274 GCGCGTGTGCGCGTGGGGCGTGG - Intergenic
960702290 3:120450704-120450726 GCTCGCGCTCGCGCTGGTGGCGG - Exonic
961540868 3:127598477-127598499 GCGCGCTGGCGCGTGGCGGGCGG + Intronic
963741582 3:149086701-149086723 CCGCGCGCCCGCCTTGGGGGCGG - Intergenic
964437988 3:156674445-156674467 GCGCACGCGCGCGCAGGGGGCGG + Intronic
965590556 3:170357366-170357388 CCGGGCGCGCGCCTGGGGGGAGG + Intergenic
966593003 3:181702016-181702038 GTGCGCGCGCGCGCATGGGGGGG - Intergenic
968636700 4:1684543-1684565 GCACGCACGCGCGCAGGGGGCGG - Intergenic
968831403 4:2934464-2934486 GGGGGCGCGCGGGGTGGGGGCGG - Intronic
968831504 4:2934706-2934728 GGGGGCGCTCGGGTTGGGGGTGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
969115498 4:4868473-4868495 GCGCGGGGGCGGGTGGGGGGGGG - Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
970593236 4:17577391-17577413 GGGCGGGCGCGCCTTGGGGCGGG - Exonic
974047120 4:56907801-56907823 ACGCGCGCGGGCGTCGGAGGGGG + Intergenic
974047129 4:56907836-56907858 GCGCGCGCGGGCGTCGGAGGGGG + Intergenic
976389602 4:84495615-84495637 GCACGCGCGCGCGACAGGGGCGG + Intronic
976733278 4:88284841-88284863 GCGCGCTTGCGCGGTGGGTGGGG + Intergenic
977908461 4:102502365-102502387 GCGCGCGCGCGCACGGAGGGGGG - Intronic
977908463 4:102502367-102502389 GCGCGCGCGCGCGCACGGAGGGG - Intronic
977937861 4:102827190-102827212 GCGCGGGCGCGTGGTGGAGGTGG - Intronic
979785704 4:124712858-124712880 GCGGGAGAGCGCGGTGGGGGAGG - Intergenic
985532727 5:443376-443398 CCGCGGGGGCGCGTAGGGGGAGG + Intronic
987082808 5:14440993-14441015 GCGCGCGCGCGCGCTGCAGTTGG - Intronic
989033989 5:37150503-37150525 GCGCGCGTGTGTGTTGGGGGAGG - Intronic
989178893 5:38556739-38556761 GGGGGCGCGCGGGTTGGGGCGGG - Intronic
989287750 5:39721721-39721743 GCCCGCCCTCGCGTTGGGGGAGG + Intergenic
992627430 5:78648460-78648482 GGGCCCGCGCGCGCTGCGGGAGG - Intronic
993519463 5:88883240-88883262 GGGAGCGCGCGCGAGGGGGGGGG + Intronic
993646858 5:90473799-90473821 GCGCGCGCTCTCGTTAAGGGAGG - Intronic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
994367111 5:98928818-98928840 GAGCGCGCGCGCGACGGCGGCGG - Exonic
995512297 5:112921719-112921741 GCGGGCGGGCGCGTTGACGGAGG - Intronic
997237153 5:132279330-132279352 GCGCGCGTGGGTGTCGGGGGTGG - Intronic
997237157 5:132279336-132279358 GCGCGCGCGCGCGTGGGTGTCGG - Intronic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
1000665423 5:163989215-163989237 GTGTGCGCGCGCGTGTGGGGGGG + Intergenic
1000665425 5:163989217-163989239 GTGCGCGCGCGTGTGGGGGGGGG + Intergenic
1001065049 5:168529523-168529545 TCGCGCGGGGGCGGTGGGGGCGG + Exonic
1002140238 5:177133533-177133555 GCGAGCGGGCGCGCAGGGGGAGG + Intronic
1002487610 5:179550519-179550541 GGGCGGGCGCGGGGTGGGGGCGG - Intergenic
1002559738 5:180072910-180072932 GCGCGCGCGCGCGTTTCGGAAGG - Intergenic
1003018736 6:2491250-2491272 ACGCTCGCGCGCGCTGGGGTTGG - Intergenic
1004561803 6:16759967-16759989 GCGCGCGCGCGCCGGGCGGGGGG - Intronic
1004561805 6:16759969-16759991 GTGCGCGCGCGCGCCGGGCGGGG - Intronic
1004615321 6:17282612-17282634 GCGGGCGGGGGCGTGGGGGGGGG - Intronic
1006121168 6:31806834-31806856 GCGAGCCCGCGCGTGGGGCGAGG + Exonic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1006665326 6:35689020-35689042 GCCCGCGCGCCTTTTGGGGGCGG - Intronic
1006694742 6:35921184-35921206 GCGCGCTTGCGCGTTGGGCGCGG + Exonic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1008160479 6:48069176-48069198 GGGCGGGAGCACGTTGGGGGTGG + Intergenic
1010379083 6:75206013-75206035 GCGCGCGGACGCGTCTGGGGCGG + Exonic
1011448958 6:87472949-87472971 GCGCGGGGGCGCGGAGGGGGCGG + Intronic
1012872901 6:104693059-104693081 ACGCGCGCGCGCGCTGGGGTGGG + Intergenic
1012872903 6:104693061-104693083 GCGCGCGCGCGCTGGGGTGGGGG + Intergenic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1013836422 6:114341593-114341615 GCGCGCGCGCGCGTGTGTGTTGG + Intronic
1016308011 6:142703477-142703499 GTGCGCGCGCATGTTGCGGGGGG - Intergenic
1018400128 6:163413967-163413989 CCGCGAGCGCGCGGTGGGGGAGG - Intergenic
1019025746 6:168961483-168961505 TCGCGCACGCGCGATGGGGTCGG + Intergenic
1022715158 7:32891900-32891922 GCGAGAGCGCGCGGCGGGGGCGG - Intronic
1022715188 7:32891997-32892019 GCGCGCGCGCGCGAGGCGGGAGG - Intronic
1023177442 7:37448129-37448151 GCGAGCGCGCTCGTGGGAGGGGG - Intronic
1023810261 7:43906360-43906382 GGCCGCGCGGGCGTGGGGGGCGG - Intronic
1025916839 7:65873120-65873142 GCGCGCGGGCGCGGAGGGAGGGG - Intergenic
1025916841 7:65873122-65873144 GCGCGCGCGGGCGCGGAGGGAGG - Intergenic
1027198241 7:76046348-76046370 GCGCGCGCGCGCTTTTGAGCCGG + Intronic
1027592555 7:80134752-80134774 GCGGGCGCGCGCTCTGGGAGTGG + Intronic
1028417457 7:90595921-90595943 GCGCGCGGGCGGGGCGGGGGAGG + Intronic
1032013410 7:128360966-128360988 GCGCGCGCGCGTGCAGGGGCAGG - Intronic
1032298798 7:130668394-130668416 GCGCGCGCGGGCGCCGGGGCGGG + Intronic
1032710931 7:134459283-134459305 GCGCGGGCGAGCGTTGGGGGCGG - Intronic
1034129283 7:148699817-148699839 GCGCGCGCTCCCGTTGGGACCGG - Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034195030 7:149239825-149239847 GCTCGAGGGCGCGTTGGGGATGG + Intronic
1034418801 7:150978414-150978436 TCGGGCGCGCGCGGTGGGGCGGG - Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1037900482 8:22685435-22685457 GCGCGCGCGCGGGGAGGGGAGGG + Intergenic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1040501461 8:48008684-48008706 GCGCGCCGGCGGGCTGGGGGCGG + Intronic
1042155426 8:65840926-65840948 GGGCGCGCGGGAGCTGGGGGAGG + Intronic
1045277795 8:100722526-100722548 GCGGCCGCGCACGTGGGGGGTGG - Exonic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1047961726 8:130016255-130016277 GGGCGCGCGCGTGATGGGTGCGG - Intronic
1048484258 8:134832346-134832368 GTGCGCGCGCGCGTGGGGAAGGG + Intergenic
1049548537 8:143246097-143246119 GGGCGCGCACGCGGTGGCGGCGG + Intergenic
1049744081 8:144255762-144255784 GTGCACGCGCGTGGTGGGGGCGG + Intronic
1051418810 9:16870806-16870828 GCGCGCGCGGGCGGGCGGGGAGG - Intronic
1051513645 9:17906610-17906632 GGGAGCGCGTGCGCTGGGGGTGG - Intergenic
1058058547 9:100473236-100473258 GGGCGCGCGCGCGGCGGGCGGGG - Exonic
1058058549 9:100473238-100473260 GCGGGCGCGCGCGCGGCGGGCGG - Exonic
1060283371 9:122228488-122228510 GCGCGCGCGAGCGGGGGGGGGGG - Intronic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1060283375 9:122228492-122228514 GAGCGCGCGCGCGAGCGGGGGGG - Intronic
1060514559 9:124257874-124257896 GCGCGCACGAGCGCTGGGGGCGG + Intronic
1061453490 9:130681578-130681600 GGGCGCGTGCGCGTGCGGGGCGG - Exonic
1061575346 9:131502887-131502909 GCGCGCGTGCGCACTGGGAGAGG - Intronic
1061976103 9:134068539-134068561 GAGCGCGCGCGCGGGGCGGGGGG + Intergenic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062341057 9:136094237-136094259 CCCCGCGCGGGGGTTGGGGGAGG + Intronic
1062579231 9:137222159-137222181 GCGGGCGCGGGCGTGGGGCGCGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203471401 Un_GL000220v1:116705-116727 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1185463045 X:341088-341110 GCGTGCGCGCCCGGTGGGGGCGG - Intronic
1186669961 X:11758204-11758226 CGGAGCGCGCGCGGTGGGGGAGG - Exonic
1187067416 X:15854599-15854621 GGGCGCGCGCGGGGTGGCGGGGG + Intronic
1187675774 X:21715316-21715338 GCGCGCTCGCGCGCTGGTGGGGG + Intronic
1189310602 X:40014816-40014838 GCGCGCGCGCTCGTGGAGCGGGG - Intergenic
1189325190 X:40107412-40107434 GAGCGCGCGCGCTTGGGTGGGGG - Intronic
1195316849 X:103687507-103687529 GCGCGCGTGCGTGATGGTGGGGG + Intronic
1197735083 X:129844189-129844211 GCGCGCGCGCGCGTGTGTGTAGG - Intergenic
1197774624 X:130110995-130111017 GCGGGCGGGCGGGGTGGGGGAGG + Intergenic
1199637917 X:149830622-149830644 GGCCGCGCACGCGTAGGGGGCGG + Intergenic
1199760114 X:150898696-150898718 GCGCGCGCGCGGGCTTTGGGCGG - Exonic