ID: 907527477

View in Genome Browser
Species Human (GRCh38)
Location 1:55062442-55062464
Sequence AGGGAGAACAGCATGTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907527477_907527481 -1 Left 907527477 1:55062442-55062464 CCAAGAGACATGCTGTTCTCCCT No data
Right 907527481 1:55062464-55062486 TCCTGGAGCATCTATTTTAGTGG 0: 1
1: 0
2: 3
3: 36
4: 328
907527477_907527483 2 Left 907527477 1:55062442-55062464 CCAAGAGACATGCTGTTCTCCCT No data
Right 907527483 1:55062467-55062489 TGGAGCATCTATTTTAGTGGAGG 0: 1
1: 0
2: 4
3: 58
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907527477 Original CRISPR AGGGAGAACAGCATGTCTCT TGG (reversed) Intronic
No off target data available for this crispr