ID: 907528133

View in Genome Browser
Species Human (GRCh38)
Location 1:55066013-55066035
Sequence GGTCTCAGTCTCATTCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907528133_907528141 29 Left 907528133 1:55066013-55066035 CCACTAGGAATGAGACTGAGACC 0: 1
1: 0
2: 2
3: 27
4: 164
Right 907528141 1:55066065-55066087 CCAGCGACACGATCTATGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 34
907528133_907528139 28 Left 907528133 1:55066013-55066035 CCACTAGGAATGAGACTGAGACC 0: 1
1: 0
2: 2
3: 27
4: 164
Right 907528139 1:55066064-55066086 ACCAGCGACACGATCTATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 28
907528133_907528142 30 Left 907528133 1:55066013-55066035 CCACTAGGAATGAGACTGAGACC 0: 1
1: 0
2: 2
3: 27
4: 164
Right 907528142 1:55066066-55066088 CAGCGACACGATCTATGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907528133 Original CRISPR GGTCTCAGTCTCATTCCTAG TGG (reversed) Intergenic
904400385 1:30252898-30252920 TCTCTCAGACACATTCCTAGAGG - Intergenic
905338707 1:37263614-37263636 TGTCTCAGTCTCCTGCCTGGAGG - Intergenic
905479429 1:38250893-38250915 GATCTCAGTCTACATCCTAGAGG - Intergenic
905653102 1:39669475-39669497 GGGCTAATTCTCATTCCCAGGGG - Intronic
905848916 1:41258354-41258376 GGATTCAGTCTCCTTCCTAGGGG + Intergenic
907528133 1:55066013-55066035 GGTCTCAGTCTCATTCCTAGTGG - Intergenic
907810898 1:57868693-57868715 GTTCTCAGTGTTATTCCCAGAGG + Intronic
907857529 1:58318459-58318481 GGTCTGAGTCACAATCCTTGAGG - Intronic
909691130 1:78409275-78409297 GGTTTCAGCCCCCTTCCTAGGGG - Intronic
914414773 1:147469428-147469450 GGATTCAGTCTCTTTCCTAGGGG + Intergenic
915844634 1:159251299-159251321 GGATTCAGCCTCTTTCCTAGGGG - Intergenic
915979498 1:160411044-160411066 TGTCTCAGTATCATCCCAAGGGG - Intronic
916053112 1:161049567-161049589 GGACTCCTTCTCCTTCCTAGAGG - Exonic
919144341 1:193614514-193614536 GATTTCAGTCTCATTCCTTCTGG + Intergenic
920034480 1:203056950-203056972 GGTCTCTGTCCCCTTCCTAACGG + Exonic
1067325026 10:45259348-45259370 GGTCTCCCTCTCATGCCGAGCGG + Intergenic
1070145363 10:73769960-73769982 GGTCTCAGTCACATCCATGGAGG - Exonic
1071285519 10:84140396-84140418 GTTCTTGGTCTTATTCCTAGGGG + Intronic
1075500038 10:122964980-122965002 GGATTCAGCCTCTTTCCTAGGGG - Intronic
1076175143 10:128362597-128362619 GGTCTCAGACAGATTCCTGGAGG + Intergenic
1076784198 10:132741365-132741387 GGTCTCAGTCTGGTTCCTGCTGG + Intronic
1079160274 11:17986020-17986042 GCTCTCAGTCTCATTCTGGGAGG - Intronic
1079583267 11:22093074-22093096 GGTCTCATTCTGTTGCCTAGCGG - Intergenic
1079921329 11:26437166-26437188 GGACTCAGCTTCTTTCCTAGGGG + Intronic
1084418403 11:69048074-69048096 GGTGTCATTCTCACTCCTAGAGG - Intergenic
1085501527 11:77029251-77029273 GGTCTCAGACTGAGTCCTAGAGG + Intergenic
1085734736 11:79029648-79029670 TTTCTCAGTCTCATTCCCAGAGG + Intronic
1086142955 11:83519110-83519132 GGTGTCAGTCTCAGTACTAGGGG + Intronic
1087105485 11:94402906-94402928 GGTCTCGGTCTCCTACCTCGTGG - Intergenic
1089945017 11:122461819-122461841 CATCTCAGTCTCAGTCCTGGTGG - Intergenic
1091151855 11:133336267-133336289 CCTCTGAGTCTCATACCTAGTGG - Intronic
1096616446 12:52835786-52835808 GCTCTCACTCCCATTCCTTGTGG - Intergenic
1096851832 12:54444543-54444565 GTTCTGAGAGTCATTCCTAGAGG + Intergenic
1098957036 12:76698177-76698199 GTTCTGGGTCTCATTCCTGGAGG + Intergenic
1106698852 13:32207438-32207460 TGTCTGAGTCTCTTTCTTAGGGG + Intronic
1107748510 13:43538851-43538873 GGTCTCACTCTCATTCACACTGG + Intronic
1107963482 13:45579008-45579030 GGTCTCACTCTCTTGCCCAGTGG - Intronic
1108893899 13:55298389-55298411 GATGTCAGTCTATTTCCTAGAGG - Intergenic
1108944107 13:56000058-56000080 GATCTCAGTCTCAAGCCTTGGGG - Intergenic
1110474114 13:75893290-75893312 GCTCTCATTCTCATTTATAGAGG - Intergenic
1110677223 13:78263171-78263193 GGGCTCAGTGTCTTTCCAAGAGG + Intergenic
1110777031 13:79419545-79419567 GGTCTCACTCACATGCCTGGTGG - Intergenic
1116320307 14:43454230-43454252 GGATTCAGTCCCATTCCTAGGGG - Intergenic
1116493881 14:45537184-45537206 GGATTCAGTCTCTTTCCTAGGGG + Intergenic
1117532810 14:56675737-56675759 GGTCTCCTTCTCTTTCCTGGTGG - Intronic
1120227693 14:81809558-81809580 AGTCTCAGTCTCAGTCATTGTGG + Intergenic
1121738595 14:96235955-96235977 TGTCTCAGTCCCATGGCTAGAGG - Intronic
1121993396 14:98582923-98582945 AGTTTCAGCCTCATTCCTGGGGG - Intergenic
1126367540 15:47911353-47911375 GGTCTCAGTTTCCTGCCTTGAGG + Intergenic
1130620236 15:85454146-85454168 GGATTCAGCCTCTTTCCTAGGGG + Intronic
1132985992 16:2767940-2767962 GGTCTCAGTCCCTTTCCTCTGGG + Exonic
1133782339 16:8949302-8949324 TGTCTCAGTTTCAATCCCAGTGG - Intronic
1133828004 16:9296086-9296108 GGTGTCAGTCTCATAAATAGGGG + Intergenic
1135038461 16:19098175-19098197 GGTCTCACTCTCATGTCTGGTGG - Intergenic
1140945369 16:79763410-79763432 GGACTTAGTCTTTTTCCTAGTGG + Intergenic
1144431724 17:15198658-15198680 GGTTTCAGCCTCCTTCCCAGGGG - Intergenic
1147460938 17:40568627-40568649 GGATTCAGCCTCCTTCCTAGGGG - Intergenic
1150817191 17:68401524-68401546 GGACTCACACTCATTCCCAGAGG - Intronic
1151228350 17:72663644-72663666 GGCCTCAGTCTCATTTCCTGCGG + Intronic
1154410451 18:14138319-14138341 GCTCTCAGTTTCTTTCCCAGGGG - Intergenic
1155552321 18:26977793-26977815 AGTCTGACTCTCATTCCAAGTGG + Intronic
1157744396 18:50122082-50122104 AGTCTCAGTCTGTTTCCTCGTGG + Intronic
1157779041 18:50421018-50421040 GGATTCAGCCTCATTCCTAGGGG + Intergenic
1159586005 18:70284195-70284217 GGTCTCACTCTGATGCCCAGTGG - Intergenic
1160182540 18:76647912-76647934 GGATTCAGCCTCTTTCCTAGGGG + Intergenic
1162082265 19:8225256-8225278 GGTCCCAGTTTCATGCTTAGAGG + Intronic
1163099047 19:15082449-15082471 GGAATCTGTCTCCTTCCTAGAGG + Intergenic
1163696971 19:18768942-18768964 AGTCTCAGTTTGATTCCAAGGGG - Intronic
1166145495 19:40831926-40831948 GGTTTCAGCCTCTTTCCAAGGGG + Intronic
1166149601 19:40862823-40862845 GGTTTCAGCCTCTTTCCAAGGGG + Intronic
925002676 2:418471-418493 TGTCTCAGTAACATTCTTAGGGG + Intergenic
925385094 2:3456521-3456543 GATGTCAGTCTCATTCCTACAGG - Intronic
931543256 2:63353338-63353360 GGATTCAGCCTCTTTCCTAGGGG - Intronic
933085885 2:78053450-78053472 GGATTCAGCCTCTTTCCTAGGGG + Intergenic
934053056 2:88226326-88226348 TGTCTCTATCTCATTACTAGTGG - Intergenic
935631541 2:105216409-105216431 GCACTTAGACTCATTCCTAGAGG - Intergenic
935938751 2:108216223-108216245 GGTCTGGGTCTCAGTCCTGGTGG + Intergenic
937119020 2:119429367-119429389 GGTCACATTCTCAGTCCTACAGG + Intergenic
937568879 2:123333105-123333127 GGCTTCAGCCTCTTTCCTAGGGG - Intergenic
939327465 2:140712268-140712290 GGCCTCAGACTGATTCCTGGAGG - Intronic
940002005 2:148975735-148975757 GGTCTCAGTGTCATTGTTACAGG - Intronic
942498693 2:176565608-176565630 GGTCACAGCCTCCTTCCTGGTGG + Intergenic
942606102 2:177692919-177692941 GGTTTCTGACTCATTCCTAGAGG - Intronic
945950672 2:216035802-216035824 GCTCTCAGTCTTAGTCCTAGTGG + Intronic
948932116 2:241138560-241138582 GGTCCCTGTCTCATTCCTTTGGG - Intronic
1169197755 20:3692611-3692633 TGCCTCACTCTCATTCCTGGTGG - Exonic
1169413319 20:5393355-5393377 GGGCTCAGACTGCTTCCTAGTGG - Intergenic
1170057223 20:12219712-12219734 GGTCTCAGTCTGATCCCATGTGG + Intergenic
1170508664 20:17054919-17054941 GGATTCAGCCTCTTTCCTAGGGG + Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1172081323 20:32343270-32343292 GGTCTCACTCTGATGCCCAGGGG + Intergenic
1176690040 21:9895220-9895242 TCTCTCACTTTCATTCCTAGAGG - Intergenic
1176977246 21:15335496-15335518 GGATTCAGTCTCTTTCCTAGGGG + Intergenic
1179167871 21:38948669-38948691 TGTCTCACTCTCCTTCCTGGAGG - Intergenic
1181329311 22:22076859-22076881 GTTCTCAGCCTAAATCCTAGAGG - Intergenic
1183732272 22:39625236-39625258 GCTTTTAGTCTCATTTCTAGAGG + Intronic
1184514927 22:44956072-44956094 GGGCTCAGTCCCCTTCCTCGCGG - Intronic
1185228331 22:49666422-49666444 GGTCGCAGCATCATTCATAGAGG - Intergenic
949725197 3:7036018-7036040 AGTCTCAGTCTCATTCTCACTGG - Intronic
951283293 3:20779327-20779349 GGTTTTAGCCTCATTCCTAGGGG - Intergenic
954486866 3:50860873-50860895 GGATTCAGTCTCTTTCCTAGGGG + Intronic
956032227 3:65050816-65050838 GGCCTCAGTCACATACCTGGTGG - Intergenic
956203952 3:66736932-66736954 GATTTCAGTCTCATTCTTAATGG - Intergenic
958443439 3:94184683-94184705 TGTCTCAGTCACATTCCTTAAGG - Intergenic
961369169 3:126419069-126419091 GGTCTCCTTCTCAGCCCTAGGGG - Exonic
961544112 3:127620158-127620180 GGTCTTTGGCTCATTCATAGTGG + Intronic
961676794 3:128572500-128572522 GGTCTCAGTTTCAGACCTATGGG + Exonic
963052859 3:141157569-141157591 GGATTCAGCCTCTTTCCTAGGGG - Intergenic
964255829 3:154773119-154773141 GGATTCAGCCTCTTTCCTAGGGG + Intergenic
974381430 4:61145482-61145504 GGTCTCAGTCCAATTCCTAGTGG + Intergenic
974589912 4:63933041-63933063 TGTCTTGGTCTCATTCTTAGAGG - Intergenic
974684514 4:65209474-65209496 TGTCTTATTCTAATTCCTAGGGG - Intergenic
978238904 4:106492332-106492354 GGACTCAGTCGCTTTTCTAGTGG + Intergenic
979576050 4:122293687-122293709 GGATTCAGCCTCCTTCCTAGGGG - Intronic
979619438 4:122782637-122782659 GGTTTGTGTCTCATTCCTAGGGG + Intergenic
982952910 4:161722847-161722869 AGTCTCAGTGGCATTCTTAGTGG - Intronic
983322537 4:166212653-166212675 GGTCTCAGAATCATTGCGAGAGG + Intergenic
984624582 4:181991592-181991614 GGTCTCAGTCTAATTCCTTGTGG + Intergenic
987358021 5:17082117-17082139 GGTCTCATTCTATTGCCTAGGGG - Intronic
989252505 5:39333643-39333665 GGTCTCCCTCTCATGCCGAGCGG + Intronic
989633330 5:43510472-43510494 GGTCTCCCTCTGATGCCTAGCGG + Intronic
990759394 5:59111656-59111678 GGTCTCTGTCTCATTCCCCTTGG - Intronic
992072994 5:73165802-73165824 GGTCTCAGTCCCAGCCCTAGGGG - Intergenic
993545367 5:89205519-89205541 GGCCTTAGTCTCATCCCAAGTGG + Intergenic
993595801 5:89853544-89853566 AGTCTCAGTCTGATTCCAAGGGG - Intergenic
993614535 5:90095525-90095547 GGACTCATTCTCATTCCAGGTGG - Intergenic
994277317 5:97854905-97854927 AGAGTCAGTCTCTTTCCTAGGGG - Intergenic
995258333 5:110072917-110072939 GGATTCAGTCTCCTTCCTAGGGG + Intergenic
998134191 5:139666173-139666195 GAGCTCAGTCTCATTTCCAGAGG + Intronic
998231171 5:140362247-140362269 GGTCTCAGTCTGATTCTCTGAGG + Intronic
999074250 5:148780061-148780083 GGATTCAGCCTCTTTCCTAGGGG - Intergenic
999217321 5:149946086-149946108 GTGCTCTGTCTCCTTCCTAGTGG - Intergenic
999474647 5:151887364-151887386 GTTTGCTGTCTCATTCCTAGAGG + Intronic
999905756 5:156139888-156139910 GGTGTCAATCTCATTCCTGAGGG - Intronic
999924677 5:156361962-156361984 TGTCTCAGTATCATTCCTTTAGG - Intronic
1005738323 6:28769336-28769358 GGTGGCAGTCTCATTCTTGGTGG + Intergenic
1008082595 6:47209842-47209864 GGTTTCAGCCTCCTTCCTAGGGG - Intergenic
1009297114 6:61965338-61965360 GGTCTCCTTCCCAGTCCTAGCGG - Intronic
1011297566 6:85840533-85840555 GGATTCAGCCTCTTTCCTAGGGG - Intergenic
1012485105 6:99712271-99712293 GGTCTCAGTCCAGTTCCTAGTGG - Intergenic
1012574465 6:100775135-100775157 GGTCACAGTTACATCCCTAGTGG - Intronic
1012656509 6:101829594-101829616 GGTCTCAGTCTGAATGCTATTGG - Intronic
1014901121 6:126966642-126966664 GGTCTGAATCTCATACCTTGTGG + Intergenic
1017068158 6:150549172-150549194 TGCCTCACTCTCAGTCCTAGGGG + Intergenic
1017484141 6:154887422-154887444 GGTCTCCGTCTCATACCATGTGG - Intronic
1018275511 6:162126214-162126236 GTTCTCATTCTCATTCCCAATGG + Intronic
1020085576 7:5308409-5308431 GGTCTCTGTCTCAGTCCCTGGGG - Intronic
1021608226 7:22431053-22431075 GGTTCCAGGCTCAATCCTAGTGG + Intronic
1023196226 7:37642245-37642267 GGATTCAGCCTCCTTCCTAGGGG + Intergenic
1030809688 7:113957858-113957880 GGATTCAGCCTCTTTCCTAGGGG + Intronic
1031438669 7:121764915-121764937 TGTTTCAGTCTCATTCTCAGAGG - Intergenic
1031627323 7:124005457-124005479 GGATTCAGCCTCATTCCTAACGG + Intergenic
1033325467 7:140374381-140374403 CGTCTCAGTCTCATGAGTAGTGG - Intronic
1035055308 7:156031337-156031359 GGTCTCAGTCTCAGCCCAAGTGG + Intergenic
1039554539 8:38467137-38467159 GGTCCCAATCTGGTTCCTAGAGG - Intronic
1039942245 8:42101237-42101259 ATTCTGAGACTCATTCCTAGAGG - Intergenic
1042250927 8:66755561-66755583 GGTCTCAGAATCCTTCCTGGTGG + Intronic
1042422684 8:68610415-68610437 GCTCTCTGATTCATTCCTAGGGG + Intronic
1042475521 8:69245049-69245071 GGTCTCCCTCTCATGCCAAGCGG + Intergenic
1043191264 8:77225600-77225622 GGATTTAGTCTCTTTCCTAGGGG + Intergenic
1043735224 8:83732459-83732481 GTTTTCAGTCACATTCCGAGGGG + Intergenic
1044125719 8:88456685-88456707 GGATTCAGCCTCTTTCCTAGGGG - Intergenic
1044419124 8:91971248-91971270 GGTCTCAGAATCATTTCTGGAGG - Intronic
1045594461 8:103636257-103636279 GGAGTCAGTCTCTTTCCTAGGGG + Intronic
1045595587 8:103650947-103650969 GGACTCAGTCCCCTTCCTAGGGG + Intronic
1047913276 8:129554341-129554363 GGTCTCAGTCCCCTTCCCATTGG + Intergenic
1049589891 8:143453115-143453137 GGTCTCACTCTCTTGCCTAGTGG + Intronic
1050264318 9:3874107-3874129 AGTCTCAGTCTCATTCTTTCAGG - Intronic
1050791954 9:9483608-9483630 GGTCTTTGTCTCATTGCTAGAGG + Intronic
1051433987 9:17010931-17010953 GGTCTCAGTTCCATCCCCAGTGG - Intergenic
1051917783 9:22229165-22229187 GGATTCAGCCCCATTCCTAGGGG - Intergenic
1052311842 9:27076050-27076072 GGATTCAGCCTCTTTCCTAGGGG + Intergenic
1053626769 9:39879765-39879787 TCTCTCACTTTCATTCCTAGAGG - Intergenic
1053779219 9:41586255-41586277 TCTCTCACTTTCATTCCTAGAGG + Intergenic
1054167179 9:61796496-61796518 TCTCTCACTTTCATTCCTAGAGG + Intergenic
1054217118 9:62370938-62370960 TCTCTCACTTTCATTCCTAGAGG + Intergenic
1054670368 9:67784402-67784424 TCTCTCACTTTCATTCCTAGAGG - Intergenic
1059023399 9:110599507-110599529 GGATTCAGCCTCCTTCCTAGGGG + Intergenic
1059508435 9:114820749-114820771 TTTCTCAGTTTCAGTCCTAGGGG + Intergenic
1188869967 X:35360583-35360605 GGATTCAGCCTCTTTCCTAGGGG + Intergenic
1189453215 X:41159010-41159032 TGTCTCATTCTTGTTCCTAGGGG - Intronic
1190132985 X:47768405-47768427 GGATTCAGCCTCTTTCCTAGGGG - Intergenic
1193498188 X:82238921-82238943 GGAATCAGTATCTTTCCTAGGGG + Intergenic
1193858811 X:86639525-86639547 GGATTCAGCCTCTTTCCTAGGGG - Intronic
1194781593 X:98030039-98030061 GGATTCAGCCTCCTTCCTAGGGG + Intergenic
1194985310 X:100483875-100483897 GGTCTCTGTCCAATGCCTAGTGG + Intergenic
1195104917 X:101594148-101594170 GGTTTCAGCCTCTTTCCTAGGGG + Intergenic
1195473731 X:105260944-105260966 GGGTTCAGCCTCTTTCCTAGGGG + Intronic
1195949339 X:110250961-110250983 TGGCTCAGTCTAATTCCAAGTGG + Intronic
1196758272 X:119177211-119177233 GGTCACAGTCACATTCCTCTGGG + Intergenic
1197332174 X:125167193-125167215 GATTTCAGTCTCATTCCCAATGG + Intergenic
1198454692 X:136804853-136804875 TGTCTCAGTCTCATTTATTGAGG - Intergenic
1200336213 X:155353887-155353909 GGATTCAGCCTCTTTCCTAGGGG - Intergenic
1200350257 X:155487340-155487362 GGATTCAGCCTCTTTCCTAGGGG + Intergenic