ID: 907534591

View in Genome Browser
Species Human (GRCh38)
Location 1:55138379-55138401
Sequence AGAACAAATAAGAGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 559}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907534591 Original CRISPR AGAACAAATAAGAGTAAAGC AGG (reversed) Intronic
900812089 1:4812937-4812959 ACAACATATCAGAGTAAAGATGG + Intergenic
901420757 1:9149652-9149674 AGCATAACTAAAAGTAAAGCTGG + Intergenic
901628698 1:10638103-10638125 AGAACAAAAAGGAAGAAAGCAGG - Exonic
902084165 1:13844902-13844924 AGAGCAGAGAAGAGCAAAGCTGG - Intergenic
902306183 1:15541259-15541281 AGAAAGAAAAAGAATAAAGCAGG - Intronic
902335253 1:15750846-15750868 GAAACAAAGAAAAGTAAAGCCGG + Intergenic
903738934 1:25547004-25547026 AGGACAAATAAAAATAAAGCAGG + Intronic
904147038 1:28401291-28401313 AAAAAAAAAAAAAGTAAAGCAGG - Intronic
905021317 1:34815132-34815154 AGAAGTAAAAAGAGAAAAGCGGG + Intronic
906179713 1:43807792-43807814 AGAAGAAAGAAGAGAGAAGCAGG + Intronic
906592933 1:47045123-47045145 AGGATAAATAAGAGTAATTCTGG - Intronic
906895192 1:49763546-49763568 AAAACAGAGAAGAGTGAAGCTGG + Intronic
907146396 1:52236932-52236954 AAAAAAAATAAGAATGAAGCAGG - Intronic
907299198 1:53475906-53475928 AGAACAAAGGAGAGCAAGGCTGG - Intergenic
907494269 1:54832702-54832724 AAAATAAATAAAAATAAAGCTGG + Intronic
907534591 1:55138379-55138401 AGAACAAATAAGAGTAAAGCAGG - Intronic
908150064 1:61291132-61291154 CGAAGAAAGAAGAGAAAAGCAGG + Intronic
908273620 1:62445985-62446007 AAAACAAATAATAATAAAGTAGG + Intronic
908777767 1:67657695-67657717 AGCACAAAAAAGAGTAAAGGAGG + Intergenic
908854948 1:68416321-68416343 AGAAGAAATCAAAGGAAAGCTGG - Intergenic
910474369 1:87591162-87591184 AGAAAACAAAACAGTAAAGCAGG + Intergenic
910814969 1:91282197-91282219 AGAAAATATAAGAGAAAAGGGGG - Intronic
911853562 1:102849929-102849951 AAAAAAAATAAGAATAAAGTGGG - Intergenic
911873984 1:103135561-103135583 ACAAGAAGTAAGAGTAAAGTTGG + Intergenic
912080226 1:105926870-105926892 AGAAAAATTAACAGTATAGCCGG - Intergenic
912567170 1:110596158-110596180 AGAAAAAAAAAGAGTAGAACTGG + Intronic
913594477 1:120360253-120360275 AGAACAAGAAAGTGAAAAGCAGG + Intergenic
914092787 1:144518733-144518755 AGAACAAGAAAGTGAAAAGCAGG - Intergenic
914305743 1:146415142-146415164 AGAACAAGAAAGTGAAAAGCAGG + Intergenic
914371660 1:147030778-147030800 AGAATAAATAGGGGCAAAGCTGG + Intergenic
914596313 1:149157664-149157686 AGAACAAGAAAGTGAAAAGCAGG - Intergenic
915521385 1:156446741-156446763 AGAACATAAAAGAGTAGAGGGGG + Intergenic
915684642 1:157619096-157619118 ACAACAGAGAAGAGTAAAGAAGG + Intergenic
916028567 1:160856496-160856518 AGAATAAATAAGAGTTTAGGAGG - Intronic
916056890 1:161074155-161074177 AGAACAAAGAAGAGGATAGCAGG - Intronic
916310696 1:163395802-163395824 AGAATAGAGAAGAGTAAAGAAGG - Intergenic
916339565 1:163714662-163714684 AGAAAGAAAAAGAGTAAAACTGG - Intergenic
916904062 1:169262604-169262626 AGAACAAAGAGGGGCAAAGCTGG + Intronic
918273752 1:182930247-182930269 AAAACAACTAAGAGAGAAGCTGG - Intronic
918438880 1:184545874-184545896 AGAAGAAATCAGAGTCAGGCTGG - Intronic
918888780 1:190235585-190235607 AGAATAAATAAGAGAAGAGACGG - Intronic
919887082 1:201942417-201942439 AGAACAAATAGGAGTTGACCTGG + Intronic
919945047 1:202312930-202312952 AGAAAAAAAAAGTGTAAGGCCGG + Intronic
921788346 1:219260393-219260415 AGAACTAATCAGAATAAAGAAGG + Intergenic
922002601 1:221495083-221495105 AGAACAAAAAAGAGGAAAGGGGG - Intergenic
922261026 1:223946458-223946480 AGAATAAAAAAGAGGAAAGAAGG + Intergenic
922736046 1:227979275-227979297 AGAATAAAAAAGAGAAAAGAAGG - Intergenic
923109947 1:230882607-230882629 AGAACAACTCAGAGTTTAGCTGG - Intergenic
923697426 1:236267220-236267242 AGAAAAGATAAAACTAAAGCTGG - Intronic
923826552 1:237506730-237506752 AGAAAGAATAAGAGAAAAACTGG + Exonic
924222195 1:241889121-241889143 AGAACTAATATAAGTGAAGCAGG - Intronic
924342195 1:243048631-243048653 AGAATAAAAAAGAGAAAAGAAGG + Intergenic
1064169277 10:13015931-13015953 AGAATAACTAAGAGTATAACTGG + Intronic
1065395543 10:25232935-25232957 GAAACAAATAAGAGTAAGGCTGG + Intronic
1065860546 10:29868946-29868968 ATAAAAAATAAGACCAAAGCGGG - Intergenic
1066146963 10:32570236-32570258 AGAAGAAATAACAGTGATGCTGG - Intronic
1066734286 10:38456912-38456934 AGAATAAAAAAGAGAAAAGAAGG - Intergenic
1066779811 10:38931911-38931933 AGAAAGAATAAGAGAAAAGAAGG + Intergenic
1066950207 10:42110515-42110537 AGAAAGAATAAGAGAAAAGAAGG - Intergenic
1067321565 10:45225561-45225583 AGATCAAAGAAGACTAATGCAGG - Intergenic
1067908306 10:50317618-50317640 AGAACAACAAAAAGTAAACCTGG - Intronic
1068036990 10:51772456-51772478 TGAAAAAATAACATTAAAGCAGG + Intronic
1068357607 10:55930002-55930024 AAAACAAATAAGAGAAAAATTGG - Intergenic
1068733746 10:60388909-60388931 AGAGGAAATAAAAGCAAAGCAGG + Intronic
1069298338 10:66875207-66875229 AGAACAAATAGGAGAGGAGCAGG + Intronic
1070764062 10:79046444-79046466 AAAAAAAAAAAGAGTAAAGCTGG + Intergenic
1071058835 10:81546208-81546230 AGACCAAATAACAGAAAAGTCGG + Intergenic
1072467243 10:95676699-95676721 AAAACAGAAAAGAGAAAAGCAGG - Intronic
1072531734 10:96325863-96325885 AGTGCAAATATGAGTAAAACTGG - Intronic
1073262641 10:102202020-102202042 AGGACAAATAAAAGTAATGATGG - Intergenic
1073533763 10:104255647-104255669 ATAACAACTAACAGTTAAGCTGG - Intronic
1073653846 10:105390984-105391006 AGGAAAAATAAGAGTAAAAATGG - Intergenic
1074204425 10:111270272-111270294 AGAAAGAATATGAGTATAGCTGG - Intergenic
1074381487 10:112984387-112984409 GGGACAAATTAGAGTAAAGGAGG - Intronic
1074394548 10:113086921-113086943 AGAACATTAAAGAGGAAAGCAGG + Intronic
1074995272 10:118752037-118752059 AGAACTAGTAAGAGTTTAGCAGG - Intronic
1075438667 10:122462436-122462458 AGGACAAATAAGAGGAATGGGGG + Intronic
1075790722 10:125082578-125082600 AAAAAAAAAAAGAGGAAAGCTGG - Intronic
1077700264 11:4434847-4434869 AAAATAAATAAGAACAAAGCAGG - Intergenic
1077773897 11:5250121-5250143 AGAATAAATTAGAGAAAAACTGG - Intronic
1077806137 11:5592953-5592975 AGAAAAAATGAGAGGAAAGTAGG + Intronic
1079550558 11:21692099-21692121 AGAACAAATAAACCTAAAGCGGG + Intergenic
1079747745 11:24155003-24155025 AGAACAGAAAAGAGAAAGGCAGG + Intergenic
1079978493 11:27123555-27123577 AGAAAAAAAAAGAGGAAAGTGGG + Intronic
1080161306 11:29179894-29179916 ACAACTAATAAGGGCAAAGCTGG - Intergenic
1080343091 11:31291725-31291747 AGAACAAATAAGAGCAGATGAGG - Intronic
1080890336 11:36403480-36403502 AGAAGCAATAAGAATCAAGCAGG - Intronic
1080891517 11:36412625-36412647 ACAAGAAAGAAGAGAAAAGCTGG - Intronic
1080908543 11:36571957-36571979 AGAACAAACTTCAGTAAAGCGGG + Intronic
1082711590 11:56559623-56559645 AAAAAAAAAAAAAGTAAAGCAGG + Intergenic
1084532466 11:69736042-69736064 AAAAAAAAAAAAAGTAAAGCTGG - Intergenic
1085168843 11:74430100-74430122 AGAACACATAAGAAGAAAGAGGG + Intergenic
1085289069 11:75384413-75384435 AAAACAAAAAAAAGTAAAGTAGG - Intergenic
1085539735 11:77255562-77255584 AAAACAAATAAAAATAAGGCTGG + Intronic
1085862819 11:80254733-80254755 GAAAGAAAAAAGAGTAAAGCTGG - Intergenic
1086830418 11:91555542-91555564 AGAACACATGAGAAAAAAGCTGG + Intergenic
1087090691 11:94269350-94269372 AGAACAAATAAGAACAAATCTGG + Intergenic
1088318884 11:108534583-108534605 AAAACAAATAAGACTAAGCCAGG - Intronic
1088528450 11:110782482-110782504 ATTACAAATAGGAGAAAAGCAGG + Intergenic
1089051208 11:115547652-115547674 AGAAAAAAAAAGAGTAAATTAGG + Intergenic
1089792512 11:120954992-120955014 ATAAGAAATAAAAGTAGAGCTGG - Intronic
1090495199 11:127205327-127205349 AGAGCAAAGAGGAGCAAAGCTGG + Intergenic
1091675311 12:2484891-2484913 AAAAGAAAGAAGAGAAAAGCTGG - Intronic
1092185723 12:6477151-6477173 AGAACAAAGAAGAATAAAATAGG + Intergenic
1093183414 12:15992694-15992716 AGAAAAGAGAAGTGTAAAGCAGG + Intronic
1093360048 12:18213962-18213984 CTGACAAATAAGAGCAAAGCTGG + Intronic
1093978706 12:25452337-25452359 AGAACAGAGAAGAGTAAAGCAGG + Intronic
1094356019 12:29578476-29578498 GGAATAAATATGGGTAAAGCTGG - Intronic
1095454962 12:42373625-42373647 AGAACACTTAAGAGTCAAACAGG - Intronic
1095528638 12:43158200-43158222 TGAACAAAGAAGAGTAGAGAGGG + Intergenic
1095550863 12:43437859-43437881 TGAACAAATTAGAGAAAAGAGGG + Intronic
1095820110 12:46468743-46468765 AGTACAATTAAGAATAAATCTGG + Intergenic
1095828521 12:46557118-46557140 GGAAAAAAAAAGAGTAAATCTGG + Intergenic
1096918966 12:55063540-55063562 AAAACAAAGAAGAATAAAGGAGG - Intergenic
1097481807 12:60136663-60136685 AGAACAAATCAGAGTGGGGCTGG - Intergenic
1098128230 12:67322288-67322310 AGAACAAAGAAAAGCAAGGCAGG + Intergenic
1098474312 12:70882492-70882514 ACAAGAAATAAGAGTCAAGGAGG + Intronic
1098516985 12:71388480-71388502 AAAATAAAGAAAAGTAAAGCTGG - Intronic
1098594725 12:72258511-72258533 AGAATTAATAAGAATAAAGTGGG + Intronic
1098816215 12:75166900-75166922 AGAGCAAATAAGCCCAAAGCAGG + Intronic
1100270023 12:93015866-93015888 AGAACAAAGAAGAGAGAAGCAGG - Intergenic
1100286623 12:93172994-93173016 AGAATGAATAAGACTCAAGCAGG + Intergenic
1100621706 12:96282461-96282483 TGGACAAATAAAAATAAAGCAGG + Intronic
1100765214 12:97856511-97856533 AGAATAACAAAGAGTAAAGAAGG + Intergenic
1101643981 12:106611504-106611526 AAAAAAAAAAAGAATAAAGCTGG - Intronic
1102319322 12:111917801-111917823 AAAACAAATAAGAAGAAAGCAGG - Intergenic
1102468575 12:113145501-113145523 AAAGCTATTAAGAGTAAAGCTGG - Intergenic
1102598869 12:114013373-114013395 AGTACAAATAAGAATAAAGAAGG + Intergenic
1102806385 12:115784554-115784576 AGAATAAATAAAAGTAACTCAGG + Intergenic
1102864414 12:116362544-116362566 AGAAAAAATTAGTGTATAGCTGG + Intergenic
1103024212 12:117560325-117560347 AGACCAAACAAGAGAAAAACTGG - Intronic
1103353407 12:120301771-120301793 ACAAAAAATAAGAGAAAAGATGG + Intergenic
1104181869 12:126389556-126389578 AGAAGAATGAAGAGAAAAGCTGG - Intergenic
1105567915 13:21569607-21569629 AGAACACATAAGAATCAAGGGGG + Intronic
1106178011 13:27347695-27347717 AGAAGAAAGAAGAAGAAAGCAGG - Intergenic
1107008027 13:35637068-35637090 ACAACAAATGAGAGAAATGCTGG - Intronic
1108381344 13:49857637-49857659 TGAAAAAATAAGAGTTAATCAGG + Intergenic
1108461481 13:50671651-50671673 AGAAAAAGAAAGAGTAAACCAGG + Intronic
1109244195 13:59933072-59933094 AAAACAAATGAGAATAAAGGAGG + Intronic
1109298041 13:60558884-60558906 TGAAGAAATAAAAGTTAAGCTGG + Intronic
1109681697 13:65759535-65759557 AGAAAAAATAAAAGTAAATGTGG + Intergenic
1109733468 13:66449379-66449401 AGAAGAAAAAAGAGAAAAGAAGG - Intronic
1109773747 13:67012342-67012364 AGAAAAAGTAAGAGTAAACCTGG + Intronic
1109860853 13:68197139-68197161 AGAGAGATTAAGAGTAAAGCAGG + Intergenic
1109927267 13:69159989-69160011 ATAACAAATAAGAGTATAATTGG + Intergenic
1110935124 13:81278296-81278318 AGAGAGAATAAGAGCAAAGCTGG + Intergenic
1111099387 13:83562767-83562789 ATAATAAATAAGAGTAGAGCTGG - Intergenic
1113516694 13:110908343-110908365 AAAACAAATCACAGGAAAGCTGG + Intronic
1113830513 13:113291907-113291929 AGAACATTTAAGAGAAAATCAGG - Intergenic
1114615260 14:24064870-24064892 AGACCAGATGAGAGGAAAGCAGG + Intronic
1115075788 14:29388692-29388714 AGAACATCTAAGATTAAATCAGG - Intergenic
1115667545 14:35569686-35569708 AGGACAAATAAGAGTTAATCAGG - Intronic
1115806083 14:37053425-37053447 AGACCAAATAAGAGTTAAAAGGG + Intronic
1115823002 14:37232611-37232633 AGAACAAATAATAGTCAAAATGG - Intronic
1116513424 14:45775626-45775648 AGAACAAACTAAACTAAAGCTGG - Intergenic
1116741026 14:48754839-48754861 AGAATAAAAAAGATTGAAGCTGG - Intergenic
1118886986 14:69875737-69875759 ACCACATTTAAGAGTAAAGCTGG - Intronic
1118975028 14:70669158-70669180 AAAATAAAAAAGAGTAAAGAGGG + Intronic
1120344947 14:83275335-83275357 AGAATAAAAAAGAGTGAAGAAGG + Intergenic
1121947970 14:98141350-98141372 GGAAAAAATAAAAGTAAAGCTGG + Intergenic
1202937449 14_KI270725v1_random:104325-104347 AGAAAGAATAAGAGAAAAGAAGG - Intergenic
1123392164 15:19887938-19887960 AGAACAAAGAACAGAGAAGCTGG - Intergenic
1124804415 15:32867164-32867186 AGAACAAATCAGAGAGAGGCAGG - Intronic
1124933504 15:34147337-34147359 AAAAAAAATAAGATTAAAGGAGG - Intronic
1125144351 15:36449376-36449398 AGAACAGTTAAGAACAAAGCCGG - Intergenic
1126287151 15:47026774-47026796 AGAACAAAGAAGAGCAGAGCTGG + Intergenic
1126532854 15:49730825-49730847 AGAACAGAGAGGAGCAAAGCTGG + Intergenic
1126905603 15:53361238-53361260 ATGACAAATAAGTGTAAAGGAGG - Intergenic
1127077342 15:55340122-55340144 AGAAAAAATAACAGTTAAGAAGG + Intronic
1127738533 15:61872258-61872280 AAAAGAAACAGGAGTAAAGCAGG + Intronic
1128408545 15:67369134-67369156 AAAACAAAAAACAGGAAAGCAGG - Intronic
1128724172 15:69975536-69975558 AGCACAAATACCAGGAAAGCAGG + Intergenic
1129567506 15:76639058-76639080 AGAATAAATAGGAGAAAAACAGG + Intronic
1130142630 15:81241854-81241876 AGAAAAAATAGGAGAAAAGGTGG - Intronic
1131569806 15:93523435-93523457 AAAACAAACAAAAGCAAAGCAGG + Intergenic
1131610528 15:93956427-93956449 CGAACAAATGAGAGAAAGGCAGG - Intergenic
1132164760 15:99575034-99575056 AGAACAAAAAAGAGAAAAAAAGG - Intronic
1132492055 16:237473-237495 AGAACAAATAAAATAAAAGCTGG + Intronic
1133128208 16:3660334-3660356 AAAACAAATGAAAGTGAAGCTGG + Exonic
1133172530 16:3990470-3990492 AAAAAAAAAAAGAGTAAATCAGG + Intronic
1133229257 16:4358815-4358837 AGCACAAATAATAGTAAAATTGG + Intronic
1134378454 16:13701622-13701644 TGAACAAAAAAGAGTCAGGCCGG + Intergenic
1135911222 16:26562791-26562813 TGAACAAAAAAGAACAAAGCAGG + Intergenic
1136938435 16:34498703-34498725 AGAAAGAATAAGAGAAAAGGAGG - Intergenic
1136961384 16:34849854-34849876 AGAAAGAATAAGAGAAAAGGAGG + Intergenic
1137306875 16:47209729-47209751 AGAACAAATTAGAGTTAGACAGG - Intronic
1137948061 16:52753599-52753621 AGAACAAAACAGAATAAACCAGG + Intergenic
1138875694 16:60946184-60946206 AGAAGAAATTAGAGCAAAACAGG + Intergenic
1139810554 16:69612906-69612928 ATAAAAAACAAAAGTAAAGCAGG + Intronic
1140942053 16:79731155-79731177 AGAACAAAAAAGAGTAAGCAAGG + Intergenic
1141417990 16:83891658-83891680 GGAACCAATAAGAGAGAAGCAGG - Intergenic
1141525775 16:84610468-84610490 AAAACAAATAAGAATAATGAGGG - Intronic
1143413646 17:6728847-6728869 AGGAGAAAGAAGAGTAAAGAGGG + Intergenic
1144215854 17:13054634-13054656 AGAACAAATAAGATTATTCCTGG + Intergenic
1144330807 17:14222559-14222581 AGAACAGGTAAGAGTAACCCAGG - Intergenic
1144400154 17:14888869-14888891 AGAATAAAAAAGAATAAAGCAGG - Intergenic
1144841158 17:18186826-18186848 AAAGCAAATGAGAGAAAAGCTGG - Intronic
1145219120 17:21074011-21074033 AGAACTTATAAGAGCAAGGCAGG - Intergenic
1145709121 17:26952606-26952628 AGAAAGAATAAGAGAAAAGAAGG + Intergenic
1145808365 17:27750615-27750637 AAAACAAATAAAACTAAAGAAGG + Intergenic
1147480759 17:40760699-40760721 ATAATAAAAAAGAGTAAAGAAGG - Intergenic
1147985072 17:44301376-44301398 ATAAAAAATAAGAGAAAAGAAGG - Intergenic
1148865781 17:50627858-50627880 AGCAGAAATAAGAGTTAATCTGG - Intergenic
1149235153 17:54581015-54581037 AGAACAAAGAAAAGTATGGCAGG + Intergenic
1150019389 17:61595407-61595429 AGAATAAAGAAGAGTCAGGCTGG - Intergenic
1150258169 17:63766281-63766303 GTACCAAATAAGAGAAAAGCAGG - Intronic
1151133157 17:71919271-71919293 AGAAAAAAACAGAGCAAAGCGGG + Intergenic
1151921547 17:77159984-77160006 AGAACAAAGAAAAGAAAATCAGG - Intronic
1151963215 17:77418337-77418359 AGAAAAAAAAAGAGCAGAGCTGG - Intronic
1203172868 17_GL000205v2_random:167209-167231 AAAACAAGTATGAGTAAAACAGG + Intergenic
1203183906 17_KI270729v1_random:93502-93524 AGAAAGAATATGAGTAAAGAAGG + Intergenic
1154515838 18:15164583-15164605 AGAAAGAATAAGAGAAAAGAAGG - Intergenic
1154519132 18:15208155-15208177 AGAAAGAATAAGAGAAAAGAAGG - Intergenic
1155047998 18:22120662-22120684 AAAAAAAAAAAGAATAAAGCTGG - Intergenic
1155735548 18:29218376-29218398 AAGACTAAGAAGAGTAAAGCTGG + Intergenic
1155757193 18:29514093-29514115 AGAACCAAAAAGAACAAAGCTGG - Intergenic
1155900551 18:31383880-31383902 AAAACAAATAATTGAAAAGCAGG - Intronic
1156092177 18:33485278-33485300 AAAAAAAATAAGGATAAAGCAGG - Intergenic
1156402539 18:36752995-36753017 AGAAAAAATAAGAGTATAAATGG + Intronic
1157024745 18:43829338-43829360 AAAAGAAATCAGAGAAAAGCTGG + Intergenic
1157295618 18:46440135-46440157 AGAACAAAGATGAGTAAAACTGG - Intronic
1157661081 18:49445522-49445544 AGGACAAATAAGTGAAAAACAGG + Intronic
1157963860 18:52186509-52186531 AGGACAAATAAGGGAAAATCAGG - Intergenic
1158033937 18:53001748-53001770 AGAAAAATTAAGATTAAAGGGGG - Intronic
1158038036 18:53058282-53058304 AGAAAAAATAAGATTTGAGCAGG + Intronic
1158682367 18:59580321-59580343 AGGACAACTCAAAGTAAAGCGGG - Intronic
1158943753 18:62430604-62430626 AGAACAAAGAAAACTCAAGCTGG + Intergenic
1160490475 18:79333417-79333439 AGATCAAATACTAGTAAACCTGG - Intronic
1161799171 19:6406090-6406112 ATAAAAAATAAAAATAAAGCGGG - Intergenic
1161908007 19:7171841-7171863 AAAACAAATAAAAGTATATCTGG - Intronic
1162538810 19:11280841-11280863 AAAAAAAAAAAGAGTAAACCTGG - Intergenic
1162538858 19:11281155-11281177 AAAAAAAAAAAGAGTAAACCTGG - Intergenic
1162642269 19:12020961-12020983 AAAAAAAAAAACAGTAAAGCAGG - Intronic
1164209527 19:23086726-23086748 AACACAAATAATAGCAAAGCTGG - Intronic
1164292615 19:23881392-23881414 AGAAGAAAAAAGAGAAAAGGAGG + Intergenic
1164452289 19:28377247-28377269 AAAACAAAAAAGAGTAGTGCAGG - Intergenic
1165852906 19:38860871-38860893 ACAACAAAAAAGAAGAAAGCAGG - Intergenic
1167500634 19:49845134-49845156 AGAAGAAATAAAAGAAAAACTGG - Intergenic
1167524534 19:49975417-49975439 AAAATAAATAAAAGTCAAGCTGG + Intergenic
926146533 2:10399920-10399942 AGAACAGACCAGAGTAAACCTGG + Intronic
926277216 2:11413459-11413481 AAAAAAAAAAAGAGTAAAGCAGG + Intergenic
926302093 2:11611834-11611856 AGAACAAATGAGTGGAAAACAGG + Intronic
926595260 2:14783132-14783154 AGAAAAAATAAAAATAAAACTGG + Intergenic
926772074 2:16387229-16387251 AGAACAGACAAGAGTCAAGCTGG + Intergenic
926894460 2:17669542-17669564 AGAACAAATAATAGAAAAACAGG + Intronic
926957692 2:18319490-18319512 AGAGAAAATAAAAGTAAAGTAGG + Intronic
927007356 2:18864548-18864570 AAAAAAAAAAAGAGTGAAGCTGG - Intergenic
927561756 2:24078238-24078260 AGAAGAAATAAGACAAAATCTGG - Intronic
928560285 2:32476311-32476333 AGAACAAGCAAAACTAAAGCAGG + Exonic
928968196 2:36998166-36998188 AAAACAAAGAATAGTAAAGAAGG - Intronic
930215827 2:48696093-48696115 AGAAGAAATAAGAGACAATCAGG - Intronic
930838810 2:55824513-55824535 AGAACAAAGACGAGTAAGACAGG + Intergenic
931276370 2:60747173-60747195 AAAATAAAAAAGAATAAAGCTGG - Intergenic
931361240 2:61579557-61579579 AGAAAAAATAAAAGAAAAGTAGG + Intergenic
931871558 2:66466380-66466402 AGGACAAATAAGACTGAAGGTGG - Intronic
931893756 2:66705419-66705441 AGGACAGATAAGAGAAAAGCAGG - Intergenic
932253278 2:70262930-70262952 AGGACAAATATGAGTTAAGCAGG + Intronic
932875931 2:75451998-75452020 ATAAATAATAAGAGTAATGCTGG - Intergenic
933292574 2:80454220-80454242 GGATCAAATAAGAGAAAAGGAGG + Intronic
934311166 2:91866040-91866062 ACAACAAAAAAGAGTAATACAGG + Intergenic
935427841 2:102939803-102939825 AAAACAAAGATGAGTACAGCAGG - Intergenic
935848353 2:107190812-107190834 AGAACTAATAAAAATAAAGCTGG + Intergenic
936498107 2:113040522-113040544 AGAACTAATAAGTGCAAGGCTGG + Intronic
936949968 2:117967798-117967820 ATTACAAACAAGAGTAAAGGTGG + Intronic
937193159 2:120124020-120124042 AGAATAAAGAAGAGGAAAGGGGG + Intronic
937561750 2:123232198-123232220 AGAACAGAGAGGAGTGAAGCTGG - Intergenic
937606471 2:123807359-123807381 AGAACAAAGAAAAGCAAGGCAGG + Intergenic
937692348 2:124770657-124770679 AGACTAAATAAGAGTGAAGGTGG - Intronic
938451169 2:131422475-131422497 AGAACCATTGAGAGTAAAACTGG + Intergenic
938573105 2:132580632-132580654 AGAAGGAATAATTGTAAAGCTGG - Intronic
939000506 2:136728508-136728530 AGAACAGAGAAGAGGGAAGCTGG - Intergenic
940333243 2:152498555-152498577 AGAAGAAGGAAGAGTAAAACTGG - Intronic
940451746 2:153845886-153845908 ATAAACAATAAGAGCAAAGCTGG + Intergenic
940757717 2:157702544-157702566 AGAAAAAATAAAAATTAAGCAGG + Intergenic
941443493 2:165568693-165568715 AGACCAACTAAGAATAAAGGTGG + Intronic
941874591 2:170419886-170419908 AAAACAAACAAGAATGAAGCCGG + Intronic
943099122 2:183466816-183466838 GGAACAAATAAGAGTTAATTGGG - Intergenic
943599413 2:189896490-189896512 AGAACAAATAAGAGATAATCTGG - Intronic
944779699 2:203005540-203005562 AAAAAAAAAAAGAGTAAAACTGG + Intronic
945011811 2:205471980-205472002 AGAATAAAAAAGAGCAAGGCTGG + Intronic
945859463 2:215104245-215104267 AGAAAAATTAAGAGTAAGGAAGG - Intronic
946745098 2:222837565-222837587 AGAAAAGAGAAGAGAAAAGCGGG - Intergenic
946885737 2:224220692-224220714 AGAGCAAATCTGTGTAAAGCTGG - Intergenic
947085938 2:226453205-226453227 AGCATAAAGAAGAATAAAGCTGG + Intergenic
947152022 2:227125528-227125550 GGAAAAAAAAAAAGTAAAGCAGG + Intronic
947196686 2:227574741-227574763 TGAATAAATAAATGTAAAGCTGG - Intergenic
947376924 2:229505436-229505458 AGCATAAAAAAGAGTAGAGCCGG + Intronic
947452549 2:230221816-230221838 CAAACAAACAAAAGTAAAGCAGG + Intronic
947681908 2:232041656-232041678 AGAGAAAATAAGAGTAAAAGAGG + Intronic
947941805 2:234063123-234063145 AGAAGAAATGAGAGAACAGCTGG + Intronic
949083180 2:242121508-242121530 AGAATAAAAAAGAGAAAAGAAGG - Intergenic
1168911657 20:1452781-1452803 TGAACAAACAAGAGAAAAGGTGG - Intronic
1169474591 20:5919435-5919457 ATAACACAAAAGAGTAAGGCAGG + Intronic
1169497250 20:6127153-6127175 AGAGCAAAGAAGAGTAAAAATGG + Intergenic
1170166975 20:13369920-13369942 AAAACAAATATGAGTAGAGTTGG + Intergenic
1170301159 20:14886071-14886093 AGCACAAATAAATGTGAAGCAGG + Intronic
1170481690 20:16772262-16772284 AGAAAAAAAAAGAATAAAGTTGG - Intergenic
1172685311 20:36749401-36749423 AAAAAAAAAAAGAATAAAGCAGG - Intergenic
1173295072 20:41748683-41748705 AGAGCAGAGAAGAGTAAAGTAGG - Intergenic
1173335242 20:42107212-42107234 AGAAAAAAGAAGAGAAAAGAAGG - Intronic
1173545059 20:43890676-43890698 AAAACAAATAAGAGAAAAAAAGG - Intergenic
1173580865 20:44145607-44145629 AAAAAAAAAAAAAGTAAAGCTGG + Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174865574 20:54132184-54132206 AAGACAAAGAAGAGAAAAGCAGG - Intergenic
1175412404 20:58779031-58779053 AGAACAAAGCAGAGAAAACCAGG + Intergenic
1176279774 20:64294116-64294138 AGAATAAAAAAGAGAAAAGAAGG - Intergenic
1176742581 21:10617492-10617514 AGAAAGAATAAGAGAAAAGAAGG + Intergenic
1176929408 21:14790178-14790200 AGACAGAATAAGAGTAAAGGAGG + Intergenic
1176981711 21:15389270-15389292 AAAACAAGTAAGAGTAATGAAGG + Intergenic
1177096468 21:16841219-16841241 GGAACAAGTTAAAGTAAAGCTGG + Intergenic
1177690878 21:24505831-24505853 AGGAAAAAAAAGAGTAAGGCAGG - Intergenic
1178181617 21:30168366-30168388 GTAACAAATCAGAGTAATGCTGG - Intergenic
1178956349 21:37025851-37025873 AGAAAAAAAAAGAGTAAAAAAGG - Intergenic
1179133170 21:38656950-38656972 AGCACATATAAGACAAAAGCAGG + Intronic
1180525456 22:16254956-16254978 AGAAAGAATAAGAGAAAAGAAGG + Intergenic
1180632579 22:17239910-17239932 AGAATAAATCACAATAAAGCAGG - Intergenic
1181584089 22:23843502-23843524 AAAAAAAAAAAGAGTAAGGCTGG + Intergenic
1182101910 22:27663343-27663365 AAAAGAAAAAAGAGCAAAGCAGG - Intergenic
1182109719 22:27714376-27714398 AGAACAAATAGGAAGAAATCAGG - Intergenic
1182346867 22:29672606-29672628 AAAAAAAATAAAAGTACAGCTGG - Intronic
1182871101 22:33648382-33648404 AGAACAAATAAGAATCGAGGAGG - Intronic
1182988309 22:34742146-34742168 GGAAGGAATAAGAGTAAAGATGG - Intergenic
1183923178 22:41185627-41185649 AAAAAAAAAAAGAATAAAGCTGG + Intergenic
1184040213 22:41938668-41938690 AGAACAATTAAGAGTAGGGCAGG - Intergenic
1184419186 22:44369660-44369682 AGAAGAAATAATAGTAGAGCAGG - Intergenic
1203290050 22_KI270735v1_random:27946-27968 AGAAAGAATAAGAGAAAAGAAGG - Intergenic
950077116 3:10195085-10195107 AGAAAAAGAAAGAGAAAAGCTGG + Intronic
950352486 3:12370038-12370060 AGAACCAAGAAGAGAAAAGATGG - Intronic
950645050 3:14372033-14372055 AGTACAAATAAGATTTCAGCAGG - Intergenic
950686854 3:14624740-14624762 AGGACAAGTAAGAGTAAACTAGG + Intergenic
951189352 3:19749909-19749931 AGAACAGAGAGGAGCAAAGCCGG - Intergenic
951219458 3:20054092-20054114 AAAAAAAATAAGTCTAAAGCCGG - Intronic
951316926 3:21198507-21198529 TGAACAAAAAAGAACAAAGCTGG - Intergenic
952460916 3:33525461-33525483 AGAACAAAGAAAAGTAAGACAGG + Intronic
952507909 3:34024338-34024360 AGAACAATAAAGAGTCAAGATGG - Intergenic
953224798 3:41009012-41009034 AGAATAAAAAAGAGTGAAGAAGG - Intergenic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
953655695 3:44851895-44851917 AGAACAACTGAGATCAAAGCTGG + Exonic
954770752 3:52966020-52966042 AAAAAAAATAGGACTAAAGCCGG + Intronic
957426588 3:80047418-80047440 AGTACACATAGGAGGAAAGCAGG - Intergenic
957438292 3:80209010-80209032 AGAAAAACTAAGAATATAGCAGG - Intergenic
957554176 3:81745076-81745098 AGAACAAATATGAGTAAGATAGG - Intronic
957695133 3:83626291-83626313 AAAAAAAAAAAGAGAAAAGCTGG + Intergenic
958473189 3:94548523-94548545 AGAACAGAGAAGAGCAAAGCTGG + Intergenic
959802787 3:110515301-110515323 CGAACAAATCAGAGTAAATTGGG + Intergenic
959973846 3:112436775-112436797 AGAACAGAAAATAGTGAAGCTGG + Intergenic
960092256 3:113653068-113653090 AGAAGAAAGAAAAGAAAAGCTGG + Exonic
960837651 3:121923762-121923784 AGAACAATTGAGAGTAGAGATGG - Intronic
961036557 3:123646714-123646736 AGTACAAACAAGAGTAGACCAGG + Intronic
961229334 3:125288213-125288235 TAAACAGATAAGCGTAAAGCAGG - Exonic
961257145 3:125565566-125565588 AGAAGAAAAAAGAGAAAACCTGG + Intronic
963461574 3:145620366-145620388 AAAAAAAAAAAGAATAAAGCAGG + Intergenic
963478713 3:145840155-145840177 AGAAGAAATCAGAGAAAAGTGGG - Intergenic
963506282 3:146189014-146189036 AGAAGCAAAAAGAATAAAGCTGG - Intergenic
963551534 3:146730179-146730201 AGAAAAAAAAAGAACAAAGCTGG + Intergenic
963776963 3:149449546-149449568 AGCAAAAATAAAACTAAAGCTGG + Intergenic
965019270 3:163206348-163206370 TGAACAAATTAGAAGAAAGCAGG - Intergenic
965362000 3:167752845-167752867 AGGATAAATAAGAGTTAAGGAGG - Intronic
965871068 3:173266006-173266028 AGAACAAACAGGAGTTAAACAGG - Intergenic
966323275 3:178724944-178724966 TGAAAAAATAAAAATAAAGCTGG - Intronic
966869679 3:184282113-184282135 AAAAAAACTAAGAGTAAAGCAGG + Intronic
966914803 3:184578746-184578768 AGAACAATTAAGGGTTGAGCTGG + Intronic
967002687 3:185351897-185351919 AGAACAAATAGAAGTAACCCTGG - Intronic
968053045 3:195669205-195669227 AAAAAAAAAAAAAGTAAAGCAGG + Intergenic
968102769 3:195979157-195979179 AAAAAAAAAAAAAGTAAAGCAGG - Intergenic
968271816 3:197408778-197408800 GGAACAAAGAACAGTTAAGCAGG + Intergenic
970632905 4:17972379-17972401 AGAACAAACAAAAGTAAAAATGG + Intronic
971316319 4:25571222-25571244 AAAAAAAAGAAGAGTGAAGCAGG - Intergenic
971754779 4:30693432-30693454 AGAACAAATAAATCTAAAGTGGG - Intergenic
971952254 4:33367752-33367774 ACAACAAATAAAATTAAATCAGG + Intergenic
972612996 4:40672384-40672406 AAAAAAAAAAAGAATAAAGCAGG + Intergenic
972941110 4:44196615-44196637 AGAACAGAGAAGAGTAAAACTGG + Intronic
973811639 4:54576138-54576160 AGAATACAGATGAGTAAAGCTGG + Intergenic
974066753 4:57085866-57085888 AGACCAAATAAAAGTGAAGGAGG - Intronic
974087326 4:57275353-57275375 GTAACAAATATGTGTAAAGCAGG - Intergenic
974653366 4:64784505-64784527 AGAAAAGATAAAAGTAAATCAGG - Intergenic
974873163 4:67669048-67669070 AGATCAAAGAACAGTAAAGAAGG + Intronic
975113118 4:70649183-70649205 CAAACAAAAAAGAGTAAAGTCGG - Intronic
975113170 4:70649512-70649534 ATTAGCAATAAGAGTAAAGCTGG - Intronic
975875971 4:78837489-78837511 AGAACACGAAAGAGTCAAGCTGG - Intronic
976579913 4:86723810-86723832 AAAATAAATAATAGTAAACCTGG + Intronic
976820925 4:89206215-89206237 TGAACAAATAACATGAAAGCTGG + Intergenic
977006550 4:91573669-91573691 AAAACAAAGAAAAGCAAAGCAGG - Intronic
977210431 4:94211898-94211920 AAGAAAAATAACAGTAAAGCTGG - Intronic
977382721 4:96296932-96296954 ACAATAAATAAGAGAAGAGCTGG + Intergenic
978074679 4:104513868-104513890 AGAACAACTAAGAGAACAGAAGG - Intergenic
978083942 4:104626737-104626759 AGAATAGAAAAGAGTAAATCAGG + Intergenic
978271129 4:106892680-106892702 AGAACAGAGAAGAGTGAAGCAGG + Intergenic
978432528 4:108648155-108648177 AGAAGAAAAAAGTGTAAAGATGG - Intergenic
979260638 4:118639903-118639925 AGAATAAAAAAGAGAAAAGAAGG - Intergenic
980007258 4:127557451-127557473 ATCACAAATCAGAGTAAAGAGGG - Intergenic
980556676 4:134415635-134415657 AGTCCAAATCAGAGTAAAGCAGG - Intergenic
981557329 4:146009005-146009027 AGAATAAAAAAGAGTGAAGAAGG - Intergenic
981737528 4:147968479-147968501 AGAACAATTAAGGGGAAAGAAGG - Intronic
982334642 4:154220496-154220518 AGCACAAATAAAAGTAAAAATGG - Intergenic
982658267 4:158175615-158175637 AGAAAAAACATGAGCAAAGCAGG + Intergenic
983465862 4:168088927-168088949 AGCAAAAAAAAGAGCAAAGCTGG + Intergenic
983929466 4:173437105-173437127 AGAACAAAGACGAGGAAAGCAGG - Intergenic
984004361 4:174291215-174291237 ACAACAAACAAGAGAAAAACAGG - Intronic
984884605 4:184439239-184439261 AGAACAGAAAAGAATAAAGGTGG - Intronic
985499303 5:231566-231588 AAAAAAAAAAAAAGTAAAGCAGG + Intronic
985950067 5:3216215-3216237 AAAATAACTAAGAGTACAGCTGG + Intergenic
986425888 5:7631149-7631171 AGAAGCCATAAGAGTAAAGCAGG - Intronic
986620790 5:9671847-9671869 AAAAAAAATAATAATAAAGCTGG + Intronic
987351815 5:17028925-17028947 AAAAAAAAAAAGAGCAAAGCTGG + Intergenic
987927677 5:24363917-24363939 AGAACAAAGAAGAGCAAAGCTGG + Intergenic
988103392 5:26710706-26710728 ATAACAAATAAAAGAATAGCTGG - Intergenic
988333934 5:29880212-29880234 AAAACAAACAAGAGAAAACCTGG - Intergenic
988811767 5:34792214-34792236 AGAAAAAAGAAAAGAAAAGCAGG - Intronic
989317494 5:40099454-40099476 AGAAAAAATAAAAAGAAAGCTGG + Intergenic
989440594 5:41467998-41468020 AAAAAAAAAAAGAATAAAGCTGG - Intronic
989560121 5:42840880-42840902 GAAACAAATAAAAGGAAAGCTGG + Intronic
990138029 5:52670710-52670732 GGAACAAATAGGAAGAAAGCTGG + Intergenic
990159865 5:52925496-52925518 AGAACAAATAAATGAAAAACTGG - Intronic
990347688 5:54885570-54885592 AGAAAAGATAAGAGTACAGCTGG - Intergenic
990596219 5:57314941-57314963 ACAACAAAAAAAAGTAATGCAGG - Intergenic
990760818 5:59127547-59127569 AGAAGAAAGAAGAGTTCAGCTGG + Intronic
990765037 5:59173048-59173070 ACAACTACTAAGAGGAAAGCTGG + Intronic
990769687 5:59229027-59229049 AGAAAAATTAAGAGTAAGGAAGG - Intronic
990840354 5:60072933-60072955 AGAACAAAAAAGAACAAATCTGG - Intronic
990877608 5:60503689-60503711 AGACCAGATAAGACAAAAGCAGG - Intronic
991148161 5:63332175-63332197 ATTACAAAAAAGAGAAAAGCAGG + Intergenic
991335324 5:65540577-65540599 AGAAGAACTGAGAGTTAAGCTGG + Intronic
991679856 5:69128111-69128133 AGAACAAAGAATAGTACAGCAGG + Exonic
991731507 5:69593954-69593976 AAAAAAAAAAAGAGTAAATCAGG + Intronic
991807939 5:70449101-70449123 AAAAAAAAAAAGAGTAAATCAGG + Intergenic
991863444 5:71033912-71033934 AAAAAAAAAAAGAGTAAATCAGG - Intergenic
992176239 5:74151509-74151531 AGAAGATATTAGAGGAAAGCAGG - Intergenic
992481145 5:77153561-77153583 AAAAAAAAAAAGAGTAAAGCTGG - Intergenic
993989994 5:94644488-94644510 AGCATAGATAAGAGTGAAGCAGG - Intronic
994031653 5:95149958-95149980 AGAACAGAGAAGAGTGAAGCTGG - Intronic
994741418 5:103624351-103624373 AAAACAAACAACTGTAAAGCTGG + Intergenic
995133664 5:108657888-108657910 AGAACAGATAAGAGTTGAGAGGG + Intergenic
995364312 5:111338903-111338925 AAAGCAAAAAAGAATAAAGCCGG - Intronic
995411588 5:111863515-111863537 AACATAAATAAGAGAAAAGCAGG + Intronic
995451835 5:112310716-112310738 AGAACAAAAAGGACTAAAGCGGG - Intronic
996427489 5:123330794-123330816 AAAAAAAAAAAAAGTAAAGCTGG - Intergenic
997063655 5:130537816-130537838 AGAGCAAAGAAGAGTAGAGAAGG + Intergenic
997195168 5:131974359-131974381 AGAAAACAAAAGAGTAAAGTTGG - Intronic
997730530 5:136169557-136169579 TGAGCAATTATGAGTAAAGCTGG + Intronic
998489395 5:142533111-142533133 AGGACAAATAGGAGAAAAGTCGG + Intergenic
998991182 5:147819199-147819221 AGAAGAAATAAGAGAAAACTAGG - Intergenic
999227753 5:150041276-150041298 AGCACAAATAGGAGTAAAGAGGG - Intronic
999877987 5:155829537-155829559 AGAATAAATCAGAAGAAAGCAGG + Intergenic
1000299575 5:159943969-159943991 AGAACCAAGAAGAATAAAACTGG - Intronic
1000448234 5:161351248-161351270 TGAAGAAAAAAGAGCAAAGCTGG + Intronic
1000641368 5:163706424-163706446 AGAACAAATCAGAGAAATCCTGG + Intergenic
1000805569 5:165786484-165786506 GGAAAAAATAAGAGCAAAGAAGG + Intergenic
1001173387 5:169442920-169442942 AGCCCAAGTAAGAGAAAAGCGGG + Intergenic
1002753344 6:141133-141155 AGAATAAAAAAGAGAAAAGAAGG + Intergenic
1003200617 6:3956866-3956888 AGAACAATGAAGAGTAGGGCAGG - Intergenic
1004113209 6:12741683-12741705 TTGACAAATAAGAGTAAAGTTGG - Intronic
1005564249 6:27073657-27073679 AGAACAAATAAGAGATAAATAGG - Intergenic
1005721666 6:28608361-28608383 AGAAGAGACAAGAGTAAAGGTGG - Intronic
1005967117 6:30734606-30734628 GGGACTAATAAGAGTCAAGCAGG - Intronic
1006149409 6:31978528-31978550 AAAACAAATAAAAATAAACCAGG - Intronic
1006506806 6:34494433-34494455 AGAACAAAGAAAAGAAATGCAGG - Intronic
1006606757 6:35262934-35262956 GGGACAAATAAGAGGAAGGCAGG - Intronic
1006640602 6:35487764-35487786 ACAACAAAAAACACTAAAGCAGG + Intronic
1006966840 6:37995641-37995663 AATACAAAGATGAGTAAAGCAGG + Intronic
1006998047 6:38281802-38281824 ATAACAAATAATAGTAAATAGGG - Intronic
1007047591 6:38793076-38793098 AGAACAAATAATTTTAAGGCTGG - Intronic
1008320094 6:50101801-50101823 AGAATAAATATGAGTTAAACTGG + Intergenic
1008794720 6:55289016-55289038 AGACCAAGGAAGAGTTAAGCTGG - Intergenic
1010112867 6:72261934-72261956 AGAACAAGTAATAATAAACCTGG - Intronic
1010293823 6:74172152-74172174 AAAACAAACAAGAGTACAGAAGG - Intergenic
1010582129 6:77612635-77612657 AGAACATATAAAAGTAATACTGG + Intergenic
1010852102 6:80789993-80790015 ATAACAAATAACTGGAAAGCTGG - Intergenic
1010878391 6:81138013-81138035 AGAGCAGAGAAGAGTGAAGCCGG + Intergenic
1010973271 6:82285643-82285665 AGAATAAATCAGAGCAAACCAGG - Intergenic
1011520155 6:88196126-88196148 AGACCAGGTAAGAGTACAGCAGG + Intergenic
1011699576 6:89942969-89942991 AGAAAAAAAATGTGTAAAGCTGG - Intronic
1012391854 6:98750641-98750663 AGAACAATTTAAAGGAAAGCTGG - Intergenic
1012782203 6:103576338-103576360 AGAACAAATACGAATCAAGTGGG - Intergenic
1013571411 6:111430064-111430086 AAAACAGATAAGAGTTAAGGAGG + Intronic
1014279662 6:119427564-119427586 AGAACAAATAAAAATAAGTCAGG - Intergenic
1014356391 6:120416379-120416401 AGAACAAATAGGAGAATAACAGG - Intergenic
1014368239 6:120572416-120572438 AGATCAAACAAGAGGAAAGAAGG + Intergenic
1014606521 6:123480678-123480700 AGAAGAAATAAGAGGAAAAATGG + Intronic
1014616241 6:123603392-123603414 AGAAAAAAAAAGAGTAAAACAGG - Intronic
1014960582 6:127679344-127679366 AGAAGAAATCAGAAAAAAGCAGG - Intergenic
1015143932 6:129964795-129964817 AGAACAAATAAGTGTCATGTGGG + Intergenic
1015651241 6:135463124-135463146 ACAAAAAAGAAGACTAAAGCAGG - Exonic
1015923460 6:138288085-138288107 ATAAAAAATAAGATTAAGGCCGG + Intronic
1016075035 6:139785769-139785791 AGAACAAAGAAAAGCAAGGCAGG - Intergenic
1016122542 6:140362025-140362047 AAAACAAATAACAGTAACGACGG - Intergenic
1016809522 6:148246005-148246027 AGAAAAAAAAAGAATTAAGCTGG + Intergenic
1018447779 6:163874131-163874153 ATAACTACTAAGAGTAAAGGAGG - Intergenic
1019456667 7:1131205-1131227 AAAAAAAAAAAGAGTAAAGCAGG + Intronic
1019807283 7:3137202-3137224 AGAACAAATCAGAGGGAGGCAGG - Intergenic
1021362705 7:19735560-19735582 AGAGCAACTAAGAGTAAAAAAGG + Intronic
1021517731 7:21506006-21506028 AGGACAAATAAAAGTAATGATGG - Intronic
1022280076 7:28899347-28899369 AGATTATATCAGAGTAAAGCTGG + Intergenic
1022336376 7:29425651-29425673 AGAAAAAATAAGATTAAACCAGG - Intronic
1022990748 7:35704952-35704974 AAAACAAAATAGAGTAAAGGAGG + Intergenic
1024020495 7:45363899-45363921 TGTGCAAATCAGAGTAAAGCTGG - Intergenic
1025059874 7:55796822-55796844 AGAATAAAAAAGAGAAAAGAAGG + Intronic
1025128076 7:56361297-56361319 AGAATAAAAAAGAGAAAAGAAGG + Intergenic
1025321648 7:58100577-58100599 AGAAAAAATATGAGAAAAGAAGG + Intergenic
1025837937 7:65113174-65113196 AGAAAGAATAAGAGAAAAGAAGG + Intergenic
1025879332 7:65519909-65519931 AGAAAGAATAAGAGAAAAGAAGG - Intergenic
1025885131 7:65582807-65582829 AGAAAGAATAAGAGAAAAGAAGG - Intergenic
1026243822 7:68600517-68600539 AGAACAAAAAAGAAGAAAGAAGG - Intergenic
1028019081 7:85749073-85749095 AGAGCAAAGAGGAGCAAAGCTGG + Intergenic
1028317250 7:89418942-89418964 AACACAAATAAGAGTACTGCAGG - Intergenic
1028377800 7:90165547-90165569 AGAACAAAAAATAGAAAAACTGG - Intergenic
1028418828 7:90609945-90609967 AAACCAAATAAGGGTAAAGCAGG - Intronic
1028960558 7:96744997-96745019 TGAAAAAATAAGAGCAAAGCAGG + Intergenic
1029380852 7:100213622-100213644 AGAACAAATATGGGCACAGCAGG - Intronic
1030958669 7:115887921-115887943 AAAACAAAAAACAGTAAAACAGG + Intergenic
1032943154 7:136819039-136819061 ATAACAAATGAAAGTGAAGCAGG + Intergenic
1032958534 7:137002065-137002087 AGAAAAAATATGAGAAAAGCCGG + Intronic
1032993526 7:137420623-137420645 AGAAAAAAAAAAAGAAAAGCAGG + Intronic
1033001453 7:137509570-137509592 AGAGCAAAAAAGAGCAAAGAAGG + Intronic
1033760578 7:144432643-144432665 AGGACAAATAACAGACAAGCAGG - Intergenic
1034844091 7:154428403-154428425 AGAACATTTAAGAGTAAATGTGG + Intronic
1035155567 7:156909341-156909363 AGAAAAATTAAGTGTAAAGTAGG - Intergenic
1035967368 8:4208309-4208331 AGAAGAAATAAAAGCAAATCAGG + Intronic
1036659119 8:10696400-10696422 AGAAAAAAAAAGAGTGGAGCAGG - Intronic
1037013247 8:13871352-13871374 AGAAAAATGGAGAGTAAAGCAGG - Intergenic
1037669264 8:21000333-21000355 AGATCAAATAAGAGGAAGCCAGG + Intergenic
1037760172 8:21736873-21736895 AGAAAAAATAAGAGAAAAGAAGG + Intronic
1037857347 8:22381266-22381288 AGAAAAAAAAAGAGTAGGGCTGG - Intronic
1038854727 8:31319209-31319231 AGAACAATAAATAGTAAAGAAGG + Intergenic
1039071615 8:33653997-33654019 AAAACAAAGAATCGTAAAGCTGG - Intergenic
1040508041 8:48069325-48069347 AAAAAAAAAAAGAGTTAAGCCGG + Intergenic
1041288030 8:56280815-56280837 AGAACAGATAAGCAGAAAGCTGG - Intergenic
1042429590 8:68689700-68689722 AGAGAAAATAAGAACAAAGCTGG + Intronic
1043448159 8:80339702-80339724 AGACTAAATTAGAGTAAAGTGGG - Intergenic
1043630919 8:82332381-82332403 AGAAAAAAGTAGACTAAAGCAGG + Intergenic
1043882281 8:85558123-85558145 GGCAAAAATAAGAGCAAAGCAGG - Intergenic
1044113721 8:88307743-88307765 AGAACAAAAAACAGAAAAGGAGG + Intronic
1044540358 8:93402031-93402053 AAGACAAATAAGAGTACATCTGG + Intergenic
1044587788 8:93884190-93884212 AGAAAAAAAAAGAGGAGAGCTGG - Intronic
1044808486 8:96033043-96033065 AAAACAAAAAAGAGGAAAACAGG - Intergenic
1045350765 8:101337037-101337059 AGGATAAATAAGAGGAAAGGAGG - Intergenic
1045602266 8:103731614-103731636 ATAATAAAAAAGAATAAAGCAGG - Intronic
1045764176 8:105647363-105647385 AGAAAAAAAAAGAGCAAAGGGGG - Intronic
1045853952 8:106740897-106740919 AGCACAAATAAGAGTAATATTGG + Intronic
1046077091 8:109325828-109325850 AAAACAAATTGGAATAAAGCAGG + Intronic
1046098559 8:109588669-109588691 AAAATAACTAAGAGAAAAGCTGG + Intronic
1046166573 8:110444340-110444362 AGAACAAATATTAATAAAGAAGG - Intergenic
1046388664 8:113538647-113538669 ATACTAAATAAGAATAAAGCTGG - Intergenic
1046701855 8:117409799-117409821 AGAAACATTAAGAGTAAAGAAGG - Intergenic
1047108268 8:121759279-121759301 ATGTCAAATAAGAATAAAGCAGG + Intergenic
1047505424 8:125475798-125475820 AAAACAAAAAAGAGTGATGCTGG - Intergenic
1047547910 8:125838350-125838372 AGAACAGAGAAGAGCAAAGTAGG + Intergenic
1048069231 8:131004289-131004311 AGAACAAAGAAAGATAAAGCTGG - Intronic
1050586101 9:7112964-7112986 GGAAAAAAAAAGAGTATAGCTGG - Intergenic
1050904259 9:10983990-10984012 ATCACAAAGAAGAGGAAAGCTGG - Intergenic
1051242943 9:15079482-15079504 AGAAGAAAGAAGAGTAACACAGG + Intergenic
1051999318 9:23257455-23257477 TGAACTAATAAGATTAAAGGTGG - Intergenic
1052363804 9:27589290-27589312 AGAACAGGGAAGAGTGAAGCTGG + Intergenic
1052963145 9:34318111-34318133 AGAACAAACAAGTCTAAAGCTGG + Intronic
1053491685 9:38510853-38510875 AAAACAAATAAGAATAAAGGAGG + Intergenic
1054964318 9:71004942-71004964 ATAAAAAAGAAGAGTAAAGAAGG + Intronic
1055187901 9:73477784-73477806 TTAAAAAATAAGAGAAAAGCAGG + Intergenic
1055582327 9:77720006-77720028 AGAACCACTGAGAGTAAAACTGG + Exonic
1056423107 9:86448790-86448812 AGAATAAATAAAAGTAAAAAAGG - Intergenic
1057238778 9:93390437-93390459 AAAACAAAGAAGAACAAAGCTGG - Intergenic
1057473550 9:95379836-95379858 AGAGCAAATGAGAGAAAAGGTGG - Intergenic
1057525787 9:95799335-95799357 TGAAGAAAGAAGAATAAAGCTGG + Intergenic
1057671980 9:97100057-97100079 AAAACAAATAATAATAAAGGAGG + Intergenic
1057773844 9:97989336-97989358 AAAACAAATATGAGTTAAGTAGG + Intronic
1058198386 9:102008141-102008163 AGAACAGAGAGGAGTGAAGCTGG + Intergenic
1059098025 9:111439938-111439960 GCAACAAAGAAGAGAAAAGCTGG + Intronic
1059170619 9:112121213-112121235 AAAACAAAGAAGGGTAGAGCTGG - Intronic
1059241286 9:112808146-112808168 AGAACAAACAAGAGGAACACGGG + Intronic
1060017949 9:120103643-120103665 AGAAGAAGAAAGAGTAAAGGTGG + Intergenic
1060250660 9:121984408-121984430 AGCACAAATAAGAGCAAACTAGG - Intronic
1203433247 Un_GL000195v1:111470-111492 AAAACAAGTATGAGTAAAACAGG - Intergenic
1185771534 X:2768801-2768823 AGAAAAAATAAGAAGAGAGCTGG + Intronic
1186724299 X:12340340-12340362 AGAATAAAGAAGAGAAAAACTGG + Intronic
1186844032 X:13513255-13513277 AAAATAAATAAGAGTATAACTGG - Intergenic
1187081943 X:15999391-15999413 AATACGAATAAGAGTAAAGAGGG - Intergenic
1187510627 X:19914458-19914480 AGAAGCAAGAAAAGTAAAGCTGG - Exonic
1187629409 X:21152261-21152283 TGAAGAAGTAAGAGTAAGGCAGG + Intergenic
1187750811 X:22462811-22462833 AAAACAAATAAAGGTAATGCAGG - Intergenic
1188031895 X:25273611-25273633 AGAAAAAATATGACTAAAGCAGG - Intergenic
1188064985 X:25648081-25648103 ACAAGAAACAAGAGTAAAGAGGG - Intergenic
1188239872 X:27772859-27772881 AGAACAAATTAGATTTAGGCTGG + Intergenic
1188779566 X:34264476-34264498 AGAACAAATAAGAGGGCAGGAGG - Intergenic
1188925464 X:36037326-36037348 ACAACAACAAAGAGTAAAGTTGG - Intronic
1189079093 X:37950463-37950485 AGAAATAATAACTGTAAAGCAGG + Intronic
1189246700 X:39568795-39568817 AGAATAAATCAGAGTGATGCAGG - Intergenic
1189946402 X:46184520-46184542 CATACAAATAAGAGAAAAGCAGG - Intergenic
1190102535 X:47532859-47532881 AGAAAAAATAAAATAAAAGCCGG + Intergenic
1190543224 X:51498929-51498951 AGAATAAATAAGAAGAAAGAAGG - Intergenic
1192618328 X:72651126-72651148 TGAACAAATGAGAATACAGCAGG - Intronic
1193098503 X:77580134-77580156 AGAATAAAAAAGAATAAAGCAGG + Intronic
1193106702 X:77683784-77683806 AGAACAAATAAAAGTACCGGTGG - Exonic
1193191404 X:78575091-78575113 AGAACAAATAAGAATTGAGTTGG - Intergenic
1193199356 X:78669768-78669790 AGAAAGCAAAAGAGTAAAGCAGG - Intergenic
1193236921 X:79117781-79117803 AGAACAAATAATAGTTACTCTGG - Intergenic
1193712610 X:84896385-84896407 AGAACAGATAAAAGCAAGGCAGG - Intergenic
1194155738 X:90386435-90386457 AGAAAAAAAAAGAATAAAGAAGG + Intergenic
1194219989 X:91177832-91177854 AGAAGAACAAAGAGTAAAGTGGG - Intergenic
1194332744 X:92603355-92603377 AGAACAATTATGAGGAAAGTGGG + Intronic
1194797541 X:98230899-98230921 AGAACAAATAAGGAAGAAGCAGG + Intergenic
1194888555 X:99348942-99348964 AGAGCAGAGAGGAGTAAAGCTGG - Intergenic
1195104970 X:101594475-101594497 AGAACAAAGAAAAGCAAAGCGGG - Intergenic
1195230608 X:102843053-102843075 AAAACAAAAAAGACAAAAGCTGG - Intergenic
1195792816 X:108607447-108607469 AGAATAAAAAATAGTTAAGCAGG - Intronic
1195913656 X:109914822-109914844 AATATAAATAAGAGTTAAGCTGG + Intergenic
1196724988 X:118887653-118887675 AGGACAAATAAAAGTAATGATGG + Intergenic
1197178244 X:123507120-123507142 AGAACAAATAAGAGTGTTGGTGG + Intergenic
1197494860 X:127165917-127165939 AGATCAACTAAAAGTAAAGATGG - Intergenic
1198065657 X:133093996-133094018 AAAAAAAAAAAGAGTAAACCAGG + Intronic
1198406314 X:136316122-136316144 AGAATTAAAAAGAGGAAAGCAGG + Intronic
1198527272 X:137514167-137514189 AAAAGAAATAAGAGGAAAGAAGG + Intergenic
1198665600 X:139018770-139018792 AAAAAAAAAAAGAGTAAAGGAGG - Intronic
1199104242 X:143843011-143843033 TGAACAAAAAAGAGCAAAGCTGG - Intergenic
1200556495 Y:4641593-4641615 AGAAGAACAAAGAGTAAAGTGGG - Intergenic
1200641439 Y:5722400-5722422 AGAACAATTATGAGGAAAGTGGG + Intronic
1201987103 Y:19980542-19980564 TGAACAAATAAGAGCAGAGGTGG - Intergenic
1202382109 Y:24282287-24282309 AGAATAAAAAAGAGAAAAGAAGG - Intergenic
1202488675 Y:25387838-25387860 AGAATAAAAAAGAGAAAAGAAGG + Intergenic