ID: 907534604

View in Genome Browser
Species Human (GRCh38)
Location 1:55138608-55138630
Sequence CTCGACAGTGAAGGTATCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907534604 Original CRISPR CTCGACAGTGAAGGTATCTT TGG Exonic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
910921715 1:92355637-92355659 CTAGAAAGAGAAGGCATCTTGGG - Intronic
911705590 1:101008609-101008631 CTAGACAGCCAAGGTTTCTTTGG + Intronic
916658080 1:166895581-166895603 CTCCTCAGTGAAGATATCTCAGG - Intergenic
920833685 1:209488159-209488181 CACTACAGAGAAGGGATCTTTGG + Intergenic
921118625 1:212117657-212117679 CTGAACAGTGGAGGTATCTGGGG + Intergenic
1067531098 10:47074124-47074146 CTTGACTGTAAAGGTTTCTTAGG + Intergenic
1072503342 10:96041268-96041290 CTCTAAAGTGAAGGCATGTTTGG - Intergenic
1077904851 11:6523287-6523309 CTGCACAGGGAAGGTCTCTTTGG + Intronic
1084633138 11:70369573-70369595 TTCACCAGTGAAGCTATCTTGGG + Intronic
1084872277 11:72106249-72106271 CAAGACAGTGAAGGAATATTTGG + Intronic
1086871135 11:92038030-92038052 CTCCTCAGTTAAAGTATCTTTGG - Intergenic
1089026247 11:115273262-115273284 CTAGACAGTGATGATGTCTTAGG - Intronic
1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG + Exonic
1091060633 11:132458093-132458115 GTGGACAGAGAAGGTCTCTTGGG + Intronic
1092163089 12:6326839-6326861 CTCGAGAGTGAAGGTAGGTGTGG + Intronic
1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG + Intergenic
1106401193 13:29432671-29432693 TTGGACAGTGAAGGGAGCTTAGG - Intronic
1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG + Intergenic
1107505090 13:41025971-41025993 TAGGACAGTGAAGGTATTTTTGG - Intronic
1112006525 13:95258472-95258494 ATCGACAATGAGGGTATGTTTGG - Intronic
1114339568 14:21728953-21728975 CTCCACAGTGTTGGTGTCTTAGG - Intergenic
1114405314 14:22450917-22450939 CTCAACACAGAAGGCATCTTTGG + Intergenic
1114472520 14:22973609-22973631 TTGGACACTGAGGGTATCTTAGG + Intronic
1117824139 14:59683518-59683540 TTCTACAGTGAATGGATCTTAGG - Intronic
1119668429 14:76500511-76500533 CTCTACTGTGAAGGTTTCTCCGG - Intronic
1128183790 15:65626872-65626894 CTCTAAAGTGAGGGTACCTTAGG + Intronic
1130998606 15:88920101-88920123 CTAAAGAGTGAAGGTATCTCTGG - Intergenic
1148569583 17:48657489-48657511 CTCTACAGTGAAGGAATTTCTGG + Intergenic
1148569591 17:48657557-48657579 CTCTACAGTGAAGGAATTTCTGG + Intergenic
1163258185 19:16170483-16170505 TATGAAAGTGAAGGTATCTTTGG - Intronic
925648604 2:6064500-6064522 CTGCACAGTGAAGATATCTGAGG - Intergenic
925657946 2:6169483-6169505 CTCGACTGTGAAAATGTCTTTGG - Intergenic
930892872 2:56411534-56411556 CTAGACAGTGAGGTTATTTTAGG - Intergenic
946675988 2:222159998-222160020 CTCGAAAGTGAATATATTTTAGG - Intergenic
1170570158 20:17628095-17628117 CTCGACTGTGAAGAGGTCTTGGG - Intronic
1178472767 21:32908693-32908715 AAGGACAGTGAAGGTTTCTTGGG + Intergenic
1182954566 22:34410148-34410170 TGAGACAGTGAAGGAATCTTCGG - Intergenic
951045790 3:18037077-18037099 CTCTACAGTGAAGACACCTTTGG + Intronic
959294979 3:104523393-104523415 CTCTACAGTTTTGGTATCTTTGG - Intergenic
973036666 4:45415747-45415769 CAAGACAGTGAAGGTGTATTGGG - Intergenic
978100880 4:104840192-104840214 CTTGACAGTGAAGACATGTTAGG + Intergenic
978246915 4:106583971-106583993 CTTGACTGTGAAAATATCTTAGG + Intergenic
982564360 4:156970680-156970702 CCAGACTGTGAAGGTATCTTTGG - Intronic
988291501 5:29294343-29294365 CTCCAGGGTGAAGGTATATTAGG + Intergenic
994012197 5:94918532-94918554 CTTGGTAGTGAAGGGATCTTTGG - Intronic
1004125084 6:12865310-12865332 CTTGACAATGATGGTATCATGGG + Intronic
1004471718 6:15935307-15935329 CTGGACAGTGAAGGGAGCCTGGG + Intergenic
1005144675 6:22675186-22675208 CATGAGAGTGCAGGTATCTTTGG - Intergenic
1005880733 6:30058057-30058079 CTACACAGAGAAGGAATCTTAGG - Intergenic
1006400095 6:33812780-33812802 CTCGGCAGTGAGGTTTTCTTAGG + Intergenic
1007702741 6:43774052-43774074 CTCGACAGTGAAGCATTCTGGGG + Intronic
1010981521 6:82375260-82375282 CTCTACAGTGAGGGAATCTCTGG + Intergenic
1021632723 7:22662625-22662647 CTCTTCAGGGATGGTATCTTGGG - Intergenic
1022031922 7:26499607-26499629 GTTGACAGTGAAGGTGTCTGGGG + Intergenic
1022833484 7:34091642-34091664 GTAGAAAGTGAAGGCATCTTAGG - Intronic
1027431166 7:78114251-78114273 CTGATCAGTGAAAGTATCTTAGG + Intronic
1028964910 7:96791478-96791500 CTTGAAAGTTAAGGTAACTTTGG + Intergenic
1032941635 7:136799468-136799490 CTCCTCAGGGAAGGTATCTGTGG - Intergenic
1033768330 7:144520083-144520105 CTCCACAGTTGAGGTCTCTTCGG + Intronic
1041486419 8:58382531-58382553 CTCCACAGTGAAGGTAACAGTGG - Intergenic
1059096582 9:111422600-111422622 CTCTACAGTGAAAGGAGCTTTGG - Intronic
1059280160 9:113126081-113126103 CTGGACAGTGAAGATCTCTGAGG + Intergenic
1059999893 9:119948768-119948790 CTGGACTATGAAGGAATCTTAGG - Intergenic
1061609776 9:131739062-131739084 CTCGACAGTCATTGAATCTTTGG + Intronic
1187986274 X:24815298-24815320 CTAGACAGAGAAGGTCTCTGTGG - Intronic
1195431288 X:104792331-104792353 CTAGACAGTGAAGCGATCTGGGG - Intronic
1195596480 X:106696989-106697011 CTTGAGATTGAAGGTTTCTTGGG + Intronic
1198482924 X:137057285-137057307 CTCTACAGTGAAGAACTCTTTGG + Intergenic