ID: 907537634

View in Genome Browser
Species Human (GRCh38)
Location 1:55179554-55179576
Sequence AAGGGGACCAGGATTTACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907537634_907537642 3 Left 907537634 1:55179554-55179576 CCCCCGTAAATCCTGGTCCCCTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 907537642 1:55179580-55179602 GTGTTCTTCATCCCAGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907537634 Original CRISPR AAGGGGACCAGGATTTACGG GGG (reversed) Intronic