ID: 907539866

View in Genome Browser
Species Human (GRCh38)
Location 1:55204968-55204990
Sequence CTGTTTGCACATTTTTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 836
Summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 752}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907539866 Original CRISPR CTGTTTGCACATTTTTAAGA AGG (reversed) Intronic
901250881 1:7778819-7778841 CTGTTTCCTCATTTGTAAAATGG + Intronic
901687493 1:10951130-10951152 CTGTTTTCACATTTTAAAGTCGG - Intronic
901951242 1:12748777-12748799 CTATTTGTCCATATTTAAGATGG - Intronic
902727301 1:18345791-18345813 CAGTTTTCACATTTGTAAAATGG - Intronic
902838040 1:19059246-19059268 CTGTTTGCTCATCTATAAAATGG + Intergenic
903185107 1:21624479-21624501 CTCTGTGCACATTTATAACATGG - Intronic
903365638 1:22804059-22804081 CTGTTTTCTCACTTGTAAGACGG - Intronic
903762724 1:25710259-25710281 CTGTTTCCACATCTGTAAGATGG + Intronic
904416378 1:30363457-30363479 CTGTTTCCTCATTTGTAAAATGG + Intergenic
904639972 1:31918558-31918580 CTGTTTCCTCATTGGTAAGAGGG + Intronic
904803869 1:33117616-33117638 CAGTTTGCTCATTTGTAAAATGG - Intronic
905058252 1:35117637-35117659 CTGTTTTCTCTTTTTTAAGGTGG - Intergenic
905821811 1:40998519-40998541 CAGTTTCCACATTGTTAAAAAGG + Intronic
905970222 1:42136307-42136329 CTGTTTCCACATCTGTAAAATGG - Intergenic
905977530 1:42188173-42188195 CTGATTGCACATTTTTCTGTAGG - Intronic
906070288 1:43011373-43011395 CTGTTTCCTCATTTGTGAGATGG + Intergenic
906166192 1:43688212-43688234 TTGTTTTTACATTTTTATGATGG - Intronic
906194986 1:43924496-43924518 GAGTTTGCACATTATTTAGAAGG + Intronic
906489587 1:46257898-46257920 CAGTTTGCTCATTTGTAAAATGG + Intronic
906505089 1:46373020-46373042 CTCTTTGCCCATTTCTAACAAGG + Intergenic
906616701 1:47237782-47237804 CTGTTTCCTCATTTTTAAAGTGG - Intergenic
907312892 1:53549847-53549869 CTGTTTGCCCATTGGTAATATGG - Intronic
907527218 1:55060884-55060906 CTGTTTACTCATTTGTAAGATGG - Intronic
907535405 1:55150746-55150768 CTGTTTGCTAAACTTTAAGAAGG - Intronic
907539866 1:55204968-55204990 CTGTTTGCACATTTTTAAGAAGG - Intronic
907607958 1:55838506-55838528 TTATTTGCCCATTTTTAAAAAGG + Intergenic
907846493 1:58213218-58213240 CAGTTTCCACATCTCTAAGAGGG + Intronic
907860096 1:58344758-58344780 CTGTTTTCTCATTTGTAACAGGG + Intronic
907880332 1:58544063-58544085 CTGTTTGCACCTCCTTTAGATGG - Intronic
908062052 1:60361048-60361070 CAGTTTGCTCATCTTTAAAATGG + Intergenic
909155249 1:72066485-72066507 CGGCTTCCACATTTTTCAGAAGG - Intronic
909504544 1:76373297-76373319 CTGTTTTCTCATCTGTAAGATGG + Intronic
909716175 1:78709729-78709751 CTGTTTGCCCACTTTTAAATTGG - Intergenic
909728277 1:78862617-78862639 ATCTTTGCACATTTTTAAAGGGG + Intergenic
909997592 1:82299494-82299516 CTGTTTTCTCATTTGTAAAATGG + Intergenic
910117167 1:83744375-83744397 CACTTTCCACATTTTTAAAATGG + Intergenic
910369109 1:86497144-86497166 CTGTTTCCCCATCTTTAAAAAGG - Intronic
910418098 1:87023218-87023240 GAGTTTGCAGATTTTTAAAAGGG - Intronic
910781808 1:90945325-90945347 CTGTTTGCAGCTTTTTAAAAAGG - Intronic
911174467 1:94805205-94805227 CTGTTTCCCCATCTTTAAAACGG - Intergenic
911262995 1:95709593-95709615 CTGTTTGCTTATTTTTAAGATGG + Intergenic
911386493 1:97181649-97181671 CTTTGTGCAGATTTTTCAGATGG - Intronic
911685657 1:100774032-100774054 CTCTTTGCCCATTTTAAAGTTGG + Intergenic
911717168 1:101146624-101146646 CTATTTGCTCATTTGTAAAATGG - Intergenic
911885950 1:103299784-103299806 ATATTTGCCCATTTTTAAAAAGG + Intergenic
912172801 1:107121240-107121262 CTGTTTCCACATTTGTAAGGTGG + Intergenic
912299713 1:108502389-108502411 CTGCTTACACATTTTCAGGAAGG - Intergenic
913146668 1:115997976-115997998 TTTTTTGCAGATTTTTATGAAGG + Intronic
913350643 1:117855016-117855038 CTGTTTTCACATCTATAAAATGG - Intergenic
913691532 1:121284391-121284413 CTGTTTTCTCATTTTTAAAATGG + Intronic
914146014 1:144995590-144995612 CTGTTTTCTCATTTTTAAAATGG - Intronic
914868374 1:151452212-151452234 CTGTTTAAAAATTTTTTAGAGGG - Intronic
915878341 1:159637464-159637486 ATGTTTAAACATTTTTATGATGG + Intergenic
916178036 1:162059130-162059152 CTGCTTACAAGTTTTTAAGATGG + Intergenic
917014382 1:170512717-170512739 CTTTTTGCCCATTTTTATGCTGG - Intergenic
917200770 1:172512276-172512298 CGATTTGCTCATCTTTAAGACGG - Intergenic
917208520 1:172604994-172605016 CTCTTTGCTCATTTTTTAGTTGG + Intronic
917781818 1:178405294-178405316 CTATATGCACATTCATAAGAGGG + Intronic
918205253 1:182302626-182302648 GTCTTTGCAGATTTTTAAAAGGG + Intergenic
918503416 1:185224031-185224053 CCTTTTGCACATTTTTAATTGGG + Intronic
918834476 1:189443856-189443878 TTTTTTTCACATTTTTTAGAGGG + Intergenic
918891173 1:190271044-190271066 CTCTTTTCACATATTTAAAATGG - Intronic
919546884 1:198934855-198934877 CTGTTTGAACATTTGAAAGGTGG - Intergenic
919773795 1:201180282-201180304 CTGTTTCCTCATTTGTAAGAAGG - Intergenic
920478859 1:206302869-206302891 CTGTTTTCTCATTTTTAAAATGG + Intronic
920917172 1:210267189-210267211 CTGTTTACACATTTTCACAAAGG + Intergenic
921567471 1:216737356-216737378 CAGTTTCCTCATTTTTAACATGG + Intronic
921580348 1:216889254-216889276 CTGACTGGACATTTCTAAGAAGG + Intronic
921680370 1:218023843-218023865 CAGTTTTCAAATTTGTAAGATGG + Intergenic
921808388 1:219481611-219481633 CTGTTTTCTTATTTTTATGAAGG - Intergenic
921814946 1:219552872-219552894 CTGTTTACAGACTTGTAAGAGGG - Intergenic
922123265 1:222696473-222696495 CAGTTTTCACACTTTTAAAATGG - Intronic
922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG + Intergenic
922884520 1:229007687-229007709 CTGTTTCCACATCTGTGAGATGG + Intergenic
923479518 1:234370252-234370274 CTTTTTGCCCATTTTCAAAATGG + Intergenic
923721705 1:236472531-236472553 CTGTTTGCTTGTTTTTGAGATGG + Intronic
1063157295 10:3391496-3391518 CATTTTCCTCATTTTTAAGATGG + Intergenic
1063696437 10:8339902-8339924 CTGTTAGCACATTTTTAAAGTGG + Intergenic
1063875861 10:10477682-10477704 ATGATTTCACATTTTTAAGAGGG + Intergenic
1063981869 10:11459462-11459484 CTCTTTTCACTTTTTTGAGACGG + Intronic
1064313332 10:14231751-14231773 TTTTTTGCTCATTTTTAAGGGGG + Intronic
1064782678 10:18859604-18859626 CAGTTTCCACATCTGTAAGATGG - Intergenic
1064800716 10:19067703-19067725 TAGTTTTCACAATTTTAAGAGGG + Intronic
1064837588 10:19551135-19551157 TCCTTTGCACATTTTTAATAAGG + Intronic
1065155261 10:22862990-22863012 CTGTTTCCTCATCTGTAAGAGGG - Intergenic
1065466188 10:26025451-26025473 CTGAGTGCACATGTTTGAGAAGG - Intronic
1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG + Intergenic
1066514582 10:36143272-36143294 CTGTGAGTATATTTTTAAGAGGG + Intergenic
1066673870 10:37867388-37867410 ATGTTTGCAGTTTTTTAAGTAGG + Intergenic
1068068396 10:52163984-52164006 CAGTTTTCACATTTTTAAAATGG + Intronic
1068307831 10:55237451-55237473 CAGTTTTCACATTTGTAAAATGG - Intronic
1068400648 10:56523350-56523372 TTGTTTGCACATATTGAAGAGGG + Intergenic
1068704189 10:60055381-60055403 CTGTTTAGCCATTTTTAGGAGGG - Intronic
1068854012 10:61778324-61778346 CTGTTTGCTCATCTGTAAAAGGG + Intergenic
1068902624 10:62287030-62287052 TTGTTTGCACCTTTATAACAAGG + Intergenic
1069427162 10:68298680-68298702 CAGTTTCCACACCTTTAAGATGG + Intronic
1069503652 10:68976860-68976882 CTATTTGTACATTCTTAAGGGGG - Intronic
1069614726 10:69799894-69799916 CAGTTTTCTCATTTGTAAGATGG - Intergenic
1069817214 10:71205877-71205899 CTGTTTTCCCATTTTTAAAAGGG + Intergenic
1071028875 10:81148225-81148247 CTGTCTCCACTTTTATAAGAGGG - Intergenic
1071260305 10:83913367-83913389 CTGTTTCCCCATCTATAAGATGG + Intergenic
1071415795 10:85440105-85440127 CTGTTTCCTCATTTGCAAGATGG + Intergenic
1072094335 10:92161959-92161981 CTGACTCCACATTTTTAAAAAGG + Intronic
1072476452 10:95765021-95765043 CTCTTTGCCCATTTTTTAAATGG + Intronic
1074790679 10:116884133-116884155 CTGCTTACACAATTTTAAGTTGG - Exonic
1075284444 10:121171506-121171528 CTGTTTCCTCATCTGTAAGATGG + Intergenic
1075907773 10:126097183-126097205 CAGACTGTACATTTTTAAGAGGG - Intronic
1076394955 10:130131549-130131571 TTGTTTGCTTATTTTTGAGATGG - Intergenic
1076635051 10:131876281-131876303 CAGTTTGCTCATCTGTAAGAGGG + Intergenic
1077204427 11:1335705-1335727 CAGTTTCCCCATTTGTAAGATGG - Intergenic
1077900386 11:6482551-6482573 CTGTGTGTACAATTTTAAAACGG + Exonic
1078022671 11:7668669-7668691 CTGTCTGCACCATTTTAAGCTGG + Intronic
1078091007 11:8264634-8264656 CTGTTTTTTCTTTTTTAAGATGG + Intronic
1078095737 11:8295675-8295697 CAATTTGTACATTTTTAAAATGG - Intergenic
1078444152 11:11391651-11391673 CATTTTGCGCATTTGTAAGACGG - Intronic
1079367208 11:19819778-19819800 CAGTTTCCACATTTGTAAAATGG - Intronic
1079384530 11:19967090-19967112 CAGTTTCCACATCTGTAAGATGG - Intronic
1079653192 11:22956782-22956804 CTGTTTGCAAGTTTTTAGAATGG - Intergenic
1080155018 11:29099671-29099693 CTATTTGCAAATATTTTAGAAGG - Intergenic
1080274993 11:30493854-30493876 CAGTTTTCACATCTCTAAGATGG - Intronic
1080534372 11:33207410-33207432 CTGTTTCCTCATTTATAAAATGG - Intergenic
1081273023 11:41110411-41110433 TAGTTTACTCATTTTTAAGATGG - Intronic
1081444329 11:43115782-43115804 CTGTTTTCTCATCTGTAAGAAGG + Intergenic
1081711654 11:45220492-45220514 CGGTTTGCACATCTGTAAGATGG - Intronic
1081715998 11:45250981-45251003 CTGTTTCCTCATCTGTAAGAGGG + Intronic
1081757547 11:45555361-45555383 CTGTTTTCTCATCTTTAAAAGGG + Intergenic
1082070360 11:47934755-47934777 CAGTTTGCACATCTGTAAAATGG - Intergenic
1083158715 11:60841667-60841689 CTGTTTTCTCATTTGTAATAGGG - Intergenic
1083336564 11:61925137-61925159 CTGTTTCCTCATCTTTAAAATGG - Intergenic
1083361350 11:62110919-62110941 CCGTCTGCACATTTTTTAGTTGG + Intergenic
1083584926 11:63849843-63849865 CTGTTTGCTCATCTGTAAAATGG + Intronic
1084315971 11:68345991-68346013 TTGTTTGCCCATTTTTGAGTTGG + Intronic
1084342565 11:68515957-68515979 CTGATTGCACAATGTTATGAAGG - Intronic
1084484881 11:69442472-69442494 CTGTTTGCACAGTTCTAATTTGG + Intergenic
1084555430 11:69872901-69872923 CTTTTTGCCCATTTTTTAAATGG + Intergenic
1084714362 11:70864228-70864250 CTATTTGCACATTTTGAAATTGG + Intronic
1084761317 11:71273039-71273061 CTGTTTTCTCATTTTTGAAATGG + Intergenic
1085331983 11:75660024-75660046 CTGTTTGGACATTTTTACTGAGG - Intronic
1085382095 11:76129103-76129125 CAGTTTCCTCATTTCTAAGATGG - Intronic
1085565625 11:77510960-77510982 TTGCTTGCACATGTTTGAGAAGG + Intergenic
1085715692 11:78871214-78871236 CTGTTTCCCCATCTATAAGACGG + Intronic
1085786328 11:79454330-79454352 CTCTCTGCAAATTTTTAGGATGG + Intergenic
1086913705 11:92502922-92502944 CTGTTTCCTCATTTCTAAAATGG + Intronic
1087178134 11:95114321-95114343 CTGATTGCCCATTTTTAAATTGG + Intronic
1087193500 11:95281423-95281445 CTGTTTTCTCATTTTTAAAGTGG + Intergenic
1087215694 11:95490826-95490848 CCCTTTGCCCATTTTTAAGCTGG + Intergenic
1087342444 11:96924440-96924462 ATATTTGCTCATTTTTAATAGGG - Intergenic
1087716880 11:101618621-101618643 CTGTTTTCTCATCTGTAAGATGG - Intronic
1088503888 11:110510646-110510668 CTGTTTGCACATCCCCAAGATGG + Intergenic
1088583386 11:111336170-111336192 CAGTTTCCCCATTTATAAGATGG - Intergenic
1088645233 11:111912335-111912357 CTGTTTGCTCTTTTTTCAGGGGG - Exonic
1088674336 11:112177705-112177727 CTGTTTCCTCTTTTCTAAGATGG - Intronic
1089511081 11:118997747-118997769 CTATTAGCGCATTTTTAAGCGGG - Intergenic
1090091652 11:123703361-123703383 CTGTTGGAACATTTTGAAAAGGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091108979 11:132947754-132947776 ATGTTTCCACATATCTAAGAGGG - Intronic
1091809680 12:3385821-3385843 GTGTAGGCACATTCTTAAGAAGG + Intronic
1092317569 12:7434361-7434383 CTTATTTCAAATTTTTAAGATGG - Intronic
1092632744 12:10400856-10400878 TTGTTTAAACATTTTTAAAAAGG + Intronic
1092852719 12:12645668-12645690 GGCTTTGCACATTTTTAAAAAGG - Intergenic
1092942031 12:13419014-13419036 CTGTTTTCCCATCTGTAAGAAGG + Intergenic
1093072597 12:14722421-14722443 CTTCTTGCCCATTTTTAAGTTGG + Intergenic
1093142870 12:15529644-15529666 TTATTTGCTTATTTTTAAGATGG - Intronic
1093145482 12:15560802-15560824 CTATTTCCACATTTCTAAAATGG - Intronic
1093159979 12:15734919-15734941 CAGTTTGCTTATTTTTAAAATGG - Intronic
1093555642 12:20470521-20470543 CCATTTGCAAATTTTTATGAGGG - Intronic
1094466610 12:30760533-30760555 TTCTTTGCACATTTTTAAATTGG - Intergenic
1095243740 12:39893033-39893055 ATATTTTCACATTATTAAGAAGG + Intronic
1095505177 12:42889268-42889290 CTTTTTGCCCATTTTTAATAAGG - Intergenic
1095804626 12:46304898-46304920 ATATTTGAGCATTTTTAAGATGG - Intergenic
1096470561 12:51872778-51872800 CTGTTTTCTCATCTGTAAGATGG + Intergenic
1097299723 12:58005215-58005237 CTGTTTCCTCATTTTGAAAATGG + Intergenic
1097348683 12:58523689-58523711 CTGTTTTCTCACTTATAAGATGG + Intergenic
1097477453 12:60075765-60075787 CTGTTTCCACATTATTAAAATGG + Intergenic
1097706036 12:62869411-62869433 CAGTTTGCACATCTATAAAATGG - Intronic
1098084790 12:66830700-66830722 CTGTTTTCTCATTTGTAAAATGG - Intergenic
1098704389 12:73668849-73668871 CTGTTTACTCATTTGTAAAATGG + Intergenic
1099032845 12:77549768-77549790 CAGTGTGCACAATTTTAAAATGG + Intergenic
1099333059 12:81316204-81316226 CTGTCTCCACACTTCTAAGAAGG - Intronic
1099780595 12:87190237-87190259 CTGCCTGCACATTTTGGAGAAGG - Intergenic
1099935380 12:89118959-89118981 CCGTTTCCACATTTATAAAATGG - Intergenic
1099954639 12:89341596-89341618 CTGTTTCCACATTTGTTAAATGG + Intergenic
1100150963 12:91737068-91737090 CTGTTTCCTCATTTATAAAATGG + Intergenic
1100222952 12:92525764-92525786 CTGTTTACTCATTTCTAAAATGG - Intergenic
1100306854 12:93358206-93358228 CTGTTTGCTCATTTGTAAAGTGG - Intergenic
1100326890 12:93548574-93548596 ATGTTTGGCCAATTTTAAGAAGG - Intergenic
1100462188 12:94810847-94810869 CCCTTTGCCCATTTTTAAGTTGG - Intergenic
1101151766 12:101889627-101889649 CCGTTTCCTCATCTTTAAGATGG + Intronic
1101238111 12:102810653-102810675 CTGTTTCCTCATTTGTAAAATGG + Intergenic
1101969058 12:109300016-109300038 CAGTTTGCACATCTATAAAATGG + Intronic
1101970543 12:109309450-109309472 CTGTTGGCAAAGTTTGAAGAGGG - Intergenic
1101989487 12:109473251-109473273 CTTTTTGTACTTTTTAAAGAAGG - Intronic
1102246586 12:111360500-111360522 CTGTTTCCACATCTGTAAAACGG + Intergenic
1102517306 12:113458438-113458460 CTGGGTGCACATTGTTAAGGAGG - Intergenic
1102543118 12:113636532-113636554 CTGTTTGCACATCTATAAAATGG - Intergenic
1103041246 12:117697249-117697271 CTGTTTTAACATTTTTAAAATGG - Intronic
1103474119 12:121205899-121205921 ATGTTTGCCCATTTTTAAATAGG + Intergenic
1103536704 12:121638476-121638498 CTGTTTTCACATCTGTAAAATGG - Intronic
1105308922 13:19189290-19189312 CTGTTTCCACCTTATGAAGAGGG - Intergenic
1105528677 13:21198861-21198883 CTGTTTCCACCTTATGAAGAGGG + Intergenic
1105535130 13:21258989-21259011 CTGTTTTCTCATTTGTAAAATGG - Intergenic
1107436415 13:40384125-40384147 CTGTTTGCTCATCTCTAAGCTGG + Intergenic
1107501757 13:40985969-40985991 TTATTTGCACAGTTTTCAGAGGG + Intronic
1108486198 13:50928727-50928749 CTGTTTCCACATCTGTAAAATGG - Intronic
1108527211 13:51295818-51295840 CTGTTTGCTCATGTGTAAAATGG - Intergenic
1108869166 13:54961224-54961246 CTGGTTGAGCATTTTTATGATGG + Intergenic
1109401279 13:61831965-61831987 CTTTATTCACATTTGTAAGATGG - Intergenic
1109455694 13:62585715-62585737 TTGTTTGTTCATTTTTCAGACGG - Intergenic
1109847982 13:68022322-68022344 TTCTTTGCACATTTTTCAGTGGG + Intergenic
1109921918 13:69075114-69075136 CTCTTTACACAATTTTAAGTGGG + Intergenic
1110508546 13:76320440-76320462 TTCTTTGCACATTTTTAATCAGG + Intergenic
1110802370 13:79713964-79713986 CTCTTTGCCCATTTTTAATAGGG - Intergenic
1110846256 13:80193547-80193569 CAGTTTGCTCATCTTTAAAATGG + Intergenic
1110931863 13:81229443-81229465 CTGATCTCAAATTTTTAAGATGG - Intergenic
1110936800 13:81300739-81300761 CTGTTTACACATTCTTAACAAGG - Intergenic
1111167369 13:84477117-84477139 CTCTTTGAACACTTTAAAGACGG - Intergenic
1111293377 13:86197145-86197167 TGGATTGCAAATTTTTAAGAGGG + Intergenic
1111697985 13:91649358-91649380 CTGGTTTCACATCTTTAAAATGG + Intronic
1112629936 13:101149402-101149424 TTGTTTACACATTTTAAAAATGG + Intronic
1112732594 13:102382299-102382321 TTATTTGCCCATTTTTAATAGGG - Intronic
1112977210 13:105335281-105335303 CAGTTTTCTCATTTTTAAAATGG + Intergenic
1113406593 13:110046511-110046533 CTGTCTGGATATTTTTAAGGAGG - Intergenic
1113884762 13:113652630-113652652 ATGTTTCCACATGTTTTAGAGGG + Intronic
1114301246 14:21380508-21380530 CTCTTTGCAGATTTTTATGGTGG - Intronic
1114346719 14:21804186-21804208 CCTTTTGTTCATTTTTAAGAAGG - Intergenic
1114752956 14:25226197-25226219 CTATTTGCTCACTTTTAAAATGG + Intergenic
1114766577 14:25378705-25378727 CTGTTTCCTCATTTTTAAGAAGG + Intergenic
1115480838 14:33859698-33859720 TTGTTTGCTTATTTTTGAGATGG + Intergenic
1116123206 14:40748006-40748028 TTGTTTGGACAATTTCAAGATGG + Intergenic
1116881669 14:50176656-50176678 CAGTTTGCTCATTTGTAAAATGG - Intronic
1117648746 14:57880153-57880175 CAGTTTCCTCATTTTTAAAATGG + Intronic
1117798695 14:59421480-59421502 CTGTTTCCTCATTTTTAAATGGG + Intergenic
1118068087 14:62214192-62214214 CTGTTTTCTCATCTTTATGATGG - Intergenic
1118258201 14:64223563-64223585 CTGTTTTGTCATTTTTAAAAGGG + Intronic
1118435682 14:65769154-65769176 CTGTTTTCTCATTTATAACATGG - Intergenic
1118572849 14:67211115-67211137 CTGTTTCCTCATTTGTAACATGG + Intronic
1118753138 14:68820908-68820930 CTGTTTCCTCATCTGTAAGATGG - Intergenic
1118859692 14:69653037-69653059 CTGTTTCCTCATTTGTAAAATGG - Intronic
1118864766 14:69694352-69694374 CAGTTTCCTCATTTTTAACATGG - Intronic
1118904210 14:70011656-70011678 CTGTTTCCCCATGTGTAAGATGG + Intronic
1118911955 14:70069032-70069054 CTGTTTTCTCATCTTTAAAATGG - Intronic
1119484548 14:74979261-74979283 CTGTTTCCTCATCTTTAAAATGG - Intergenic
1119630173 14:76223751-76223773 CTTTTTGCCCATTTTTAAATTGG - Intronic
1120028761 14:79615923-79615945 CAGTTTCCTCATTCTTAAGATGG - Intronic
1120176347 14:81297503-81297525 CTGTTTCCTCACTTTTAAGGAGG + Intronic
1120311382 14:82832260-82832282 GTGTTAGGACATTTTTGAGATGG - Intergenic
1120419581 14:84266729-84266751 CTTTTTGCCCATTTTTAATAGGG + Intergenic
1120808357 14:88776874-88776896 CTGTTTTTTCATTTTTGAGACGG - Intronic
1121385261 14:93515712-93515734 CTTTTTGCTCATTTTTAAATTGG + Intronic
1121574525 14:94972775-94972797 CTGTTTCCTCATTTATAAAATGG + Intergenic
1121724114 14:96133708-96133730 CTGTTTCCTCATTTGTAAAATGG + Intergenic
1122157784 14:99760787-99760809 CTGTTTGCTCCATTATAAGATGG - Intronic
1122297372 14:100713058-100713080 CGGTGAGCACATTTGTAAGATGG - Intergenic
1122494399 14:102141616-102141638 CTATTTGCACCTCTTTAAAAAGG + Intronic
1122813853 14:104302600-104302622 CTGTTTGCTCATCTGTAAAATGG + Intergenic
1123584977 15:21751711-21751733 TTATTTGAACATTTTTAAGTAGG + Intergenic
1123621624 15:22194318-22194340 TTATTTGAACATTTTTAAGTAGG + Intergenic
1124019571 15:25907254-25907276 CTTTTTGCACATTGCAAAGATGG + Intergenic
1124817599 15:33011766-33011788 CTTTTTGCTCATTTTTCACATGG - Intronic
1125051997 15:35310328-35310350 CTTTTTGCACATCTTAAAAAGGG + Intronic
1125122484 15:36178524-36178546 CTGTTGGAACATTTCTAAGCGGG - Intergenic
1125327159 15:38547685-38547707 TTGTTTGCCCGTTTTTAAAATGG - Intronic
1125406358 15:39356104-39356126 CTGCATTCATATTTTTAAGAGGG - Intergenic
1125588842 15:40842273-40842295 CTGTTTGCTCATTTGTAAAATGG + Intergenic
1126021689 15:44408414-44408436 CTGTTAGCAAAGTTTTAATATGG - Intronic
1126528855 15:49689573-49689595 CTGGGTGCACATTTTCAAGGTGG + Intergenic
1127283923 15:57516332-57516354 CAGTTTCCTCATATTTAAGATGG + Intronic
1127383427 15:58448715-58448737 CTGTTTTCCCATTTTTAAAATGG - Intronic
1127814429 15:62594960-62594982 TTCTTTGCTCATTTTTAATAGGG - Intronic
1127915049 15:63448444-63448466 CAGTTTCCTCATTTTTAAAACGG - Intergenic
1129151312 15:73689641-73689663 CAGTTTGCTCATTTGTAAAATGG - Intronic
1129382454 15:75176844-75176866 CAGTTTCCTCATTTATAAGATGG - Intergenic
1130018195 15:80203327-80203349 CAGTTTCCACATTTATAAAATGG - Intergenic
1130071864 15:80654249-80654271 CTGTTTTAACATCTGTAAGATGG + Intergenic
1130121874 15:81057121-81057143 CTGTTTGCCCAGTTTTTAGTTGG + Intronic
1130255137 15:82322480-82322502 CGGTTTCCCCATCTTTAAGATGG + Intergenic
1130528452 15:84726779-84726801 CTATTTTTACTTTTTTAAGATGG - Intergenic
1130599837 15:85267526-85267548 CGGTTTCCCCATCTTTAAGATGG - Intergenic
1131024656 15:89129731-89129753 CTATTTCCTCATTTGTAAGATGG + Intronic
1131349675 15:91687621-91687643 TCTTTTGCACATTTTTAAAATGG - Intergenic
1131365881 15:91839110-91839132 CTGTTTGCTTATCTTTAAAATGG - Intergenic
1131467885 15:92670052-92670074 CTGTTTCCTCATTTGTAAAATGG + Intronic
1131671061 15:94619911-94619933 GTGTTTATACATTTTAAAGAAGG + Intergenic
1131780321 15:95849413-95849435 CTCTTTGCCTATTTTTAAGCAGG + Intergenic
1132122346 15:99187658-99187680 ATCTTTGCACATTTTTAATAGGG - Intronic
1132208118 15:100000294-100000316 CTGTCTTCACATATTTAAGAAGG - Intronic
1132600713 16:771501-771523 TTGTTTGCTTATTTTTGAGATGG - Intronic
1133372298 16:5254472-5254494 ATGTTTACACTTTTTTAAAAAGG + Intergenic
1133865841 16:9642731-9642753 CTGTTTCCTCATCTGTAAGATGG - Intergenic
1134421031 16:14089952-14089974 TTATTTGCCCATTTTTAAAATGG + Intronic
1134781637 16:16903445-16903467 CTTTTTGCTCATTTTTAAATGGG + Intergenic
1135696384 16:24590846-24590868 CTTTTTGCCCAATTTTAAGTTGG + Intergenic
1136047885 16:27629704-27629726 TTGTTTGCTCATCTTTAAAATGG + Intronic
1136603587 16:31315113-31315135 CTCTTTGCCCATTTTTAAATTGG + Intronic
1137299698 16:47136961-47136983 GTTTTGGCACATTTTTATGATGG - Intronic
1137477543 16:48822915-48822937 TTCTTTGCACATTTTTAATTGGG + Intergenic
1138129366 16:54466564-54466586 CAGTTTGCTCATCTGTAAGATGG + Intergenic
1139738359 16:69013318-69013340 CTGTGTACATATTTTTAAAATGG - Intronic
1139969909 16:70767753-70767775 CTGTTTCCTCATTTGTAAGATGG + Intronic
1140266491 16:73425752-73425774 CTGTGTGCTAATTTTTCAGATGG - Intergenic
1140531557 16:75671079-75671101 CTGTTTTTCCATTTTTAATAGGG - Intronic
1141001845 16:80315853-80315875 ATGTTTTCATATTTTTAAGTGGG - Intergenic
1141068499 16:80932698-80932720 TTTTTTTCTCATTTTTAAGATGG + Intergenic
1141082545 16:81065160-81065182 CTGTTTGCTCATCTATAAAAAGG + Intronic
1141683977 16:85559709-85559731 CTGTTTTCCCATTTGTAAGATGG + Intergenic
1141713760 16:85715370-85715392 CAGTTTCCACATTTGTAAGATGG - Intronic
1141719702 16:85749583-85749605 CTGTTTCCTCATCTTTAAAATGG + Intronic
1142838270 17:2606118-2606140 CTATTTACCCATTTTTAAAAAGG - Intronic
1143152117 17:4814108-4814130 CTCTTTGCTCATTTTTCAGTTGG + Intronic
1144854781 17:18261717-18261739 CTGTTTGCTCACCTGTAAGATGG - Intronic
1145823584 17:27859481-27859503 CTGTTTTCTCATCTATAAGATGG - Intronic
1145981404 17:29014288-29014310 CTGTTCCCACATTTTAAAAATGG - Intronic
1146129640 17:30260262-30260284 GTGTTTGCACTGGTTTAAGAAGG - Intronic
1146761781 17:35485347-35485369 CCCTTTGCACATTTTTTAAATGG + Intronic
1146818017 17:35960244-35960266 CTGTTTCCTCATTTGTAAAATGG + Intergenic
1147184800 17:38707243-38707265 CTGTTTGAACTTTTTTATTATGG + Intronic
1147504201 17:40999130-40999152 CTGTTTTTACCTTTTTAAAATGG + Intergenic
1147865485 17:43549276-43549298 CTGTTTCCTCATTTGTAAAATGG - Intronic
1148840399 17:50492372-50492394 CTGTTTCCTCATTTGTAAAATGG - Intergenic
1149167710 17:53773414-53773436 TTCTTTGCCCATTTTTAAGTTGG + Intergenic
1149245970 17:54708272-54708294 CAGTTTACACATTATGAAGATGG + Intergenic
1149278162 17:55068763-55068785 CAGTTTGCTCATTTTTATAATGG - Intronic
1150401966 17:64864883-64864905 CTGTTTCCACAGTCTTAATATGG - Intronic
1150937412 17:69651797-69651819 CAGTTTTCTCATCTTTAAGATGG - Intergenic
1151306574 17:73266518-73266540 CTGTTTGCTCATCTGTAAAAGGG - Intergenic
1151352214 17:73538482-73538504 ATGCTTGCACATTTTAAAGCCGG - Intronic
1151388509 17:73770257-73770279 CTGTTTTCTCATCTTTAAAATGG - Intergenic
1152707783 17:81853946-81853968 TTGTTTGCACAGTGTCAAGATGG - Intronic
1153479931 18:5537058-5537080 CTGTTTGCTCGTTTATAAAATGG - Intronic
1154967443 18:21373637-21373659 CTTTTTGAACATTTTTTAGCTGG + Intronic
1155547321 18:26928952-26928974 CTGTTTCCTCATTTTTAAAGTGG + Intronic
1156701652 18:39833284-39833306 CTGACTGCACATTTTAAAAATGG - Intergenic
1157099379 18:44715570-44715592 GTGTTTGCTCATATTTAATAAGG + Intronic
1157292230 18:46418053-46418075 CTGTTTTCACTTTTTTAATGTGG - Intronic
1157339312 18:46765220-46765242 CTGTTTTCACACTTGTAAGTTGG - Intergenic
1157343741 18:46804436-46804458 CTGTTTCCACATTTGTAATATGG + Intergenic
1158249149 18:55467379-55467401 CTGTATGCCCATTTTTAAATTGG + Intronic
1159684138 18:71395331-71395353 ATGCGTGCACATTTCTAAGAGGG + Intergenic
1159845792 18:73458385-73458407 CTGTTTCCTCCTTTTTAAAATGG + Intergenic
1160311572 18:77796767-77796789 CTTTTTGCAATTTTTTGAGAAGG + Intergenic
1160704096 19:521487-521509 TTGTTTGTTCATTTTTGAGACGG + Intergenic
1161630489 19:5352611-5352633 CTGTTTGCTCAACTTTCAGAAGG - Intergenic
1163598890 19:18236242-18236264 CTGTTTTTATTTTTTTAAGATGG + Intronic
1164033023 19:21427512-21427534 CTGTTTCAACATTTTTAACATGG + Exonic
1164633503 19:29776699-29776721 CTGTTTGTTTATTTTTGAGACGG - Intergenic
1164832738 19:31335090-31335112 TTGTTTTCCCATTTTTAAGAGGG + Intronic
1165817659 19:38652268-38652290 CTGTTTGCCCTCTTGTAAGAGGG + Intronic
1166235761 19:41455004-41455026 CAGTTTCCACATTTCTATGAAGG + Intergenic
1166534343 19:43562922-43562944 CCGTTTGCTCATGTGTAAGATGG - Intronic
1166625866 19:44355633-44355655 CTGTTTGCTTATCTTTAAAATGG + Intronic
1166695286 19:44848331-44848353 CTGTTTCCTCATCTCTAAGATGG - Intronic
1166839484 19:45687926-45687948 CAGTTTGCTCCTTTTTAAGAGGG + Intronic
1168330101 19:55563204-55563226 CTGTGGGCACAATTCTAAGAGGG - Intergenic
926463005 2:13156529-13156551 CTGTTTCCTAATTTTTAATAAGG - Intergenic
926678033 2:15642866-15642888 CTGCTTGCCCATTTTCCAGAAGG + Intergenic
926717671 2:15938007-15938029 GTATTTCAACATTTTTAAGAGGG + Intergenic
927189221 2:20505455-20505477 CTTTTTGCCCATTTTTAAGTGGG + Intergenic
927303516 2:21543151-21543173 CTGTGTGCACATTTTTATTTAGG + Intergenic
927823924 2:26294107-26294129 CTATTTGCCCATTTTTAAATGGG - Intergenic
928219151 2:29388552-29388574 CAGTTTCCCTATTTTTAAGATGG + Intronic
928474531 2:31613333-31613355 CTCTTTGCTCATTTTTTAGTTGG - Intergenic
929060121 2:37914986-37915008 CTGTTTGCAGTGTTTTTAGATGG + Intergenic
929887793 2:45893973-45893995 CAGTTTGCCCATTTGTAAAATGG + Intronic
929964751 2:46525794-46525816 CTGTCTGCAGATGTTTTAGAAGG - Intronic
930356100 2:50322439-50322461 GTGTTTGCATACTTTTAAAAAGG - Intronic
930415765 2:51089406-51089428 CTGTTTTCCCATTTATAAAATGG - Intergenic
930557219 2:52913453-52913475 TTATTTACACATTTTTGAGAAGG + Intergenic
930920988 2:56753514-56753536 TTGTTTTCTCTTTTTTAAGAGGG + Intergenic
930949605 2:57123927-57123949 TTATTTGCACATTTATAATAAGG - Intergenic
931565215 2:63609063-63609085 CCATTAGCACATTTTTAACAAGG - Intronic
931648440 2:64446981-64447003 TTATTTGCACATTTTTATGGGGG - Intergenic
931679006 2:64727600-64727622 CTGTTTCCTCATTTGTAAAATGG + Intronic
932039219 2:68281411-68281433 CTGTTTTCACATTTGTAAAATGG + Intergenic
932202504 2:69843842-69843864 CTGTTTTGAGATTTTAAAGAAGG + Intronic
932288671 2:70556722-70556744 CGGTTTCCACATTTTCAATAAGG + Intergenic
932763090 2:74452760-74452782 CAGTTTCCTCATTTATAAGATGG + Intergenic
932986704 2:76734588-76734610 TTGTTTGCATAATTATAAGAGGG + Intergenic
933034974 2:77385021-77385043 CTTTTTGCACATTTTTAGCTTGG - Intronic
933277644 2:80301035-80301057 GTGTTTGCATATTTCTGAGATGG - Intronic
934109471 2:88728655-88728677 CTTTTGTCACCTTTTTAAGAAGG + Intronic
934865141 2:97802185-97802207 CTCTTTACACATTTTTAGAAGGG + Intronic
934908546 2:98228728-98228750 CTGTTTCCTCATCTTTAAAATGG + Intronic
934990556 2:98917643-98917665 ATGTATACACATTTTTAAAAAGG - Intronic
935004175 2:99054666-99054688 CTCTTTGCCCATTTTTAAATTGG - Intronic
935556771 2:104518925-104518947 CTGGTTACAGATTTTTAAAAAGG + Intergenic
936418413 2:112341192-112341214 CTGTTTGCCCATCTTTAAAATGG - Intergenic
936465470 2:112744848-112744870 CTGTTTGCACATATAAAAGGTGG - Intronic
937102855 2:119284956-119284978 CAGTTTTCTCATTTGTAAGAAGG + Intergenic
937393137 2:121510147-121510169 CTTTTTCCAGTTTTTTAAGATGG - Intronic
937717020 2:125043929-125043951 TTTTTTGCACATTTTTAATTGGG - Intergenic
937881063 2:126865207-126865229 CTGTTTCCTCATTTGTAAAATGG - Intergenic
939064028 2:137460695-137460717 CTTTTTGTATATTTATAAGAAGG + Intronic
939260303 2:139799480-139799502 CTGTTCTAAGATTTTTAAGAAGG + Intergenic
940142022 2:150501941-150501963 CTTTTTACAGATTTTTAAGGTGG + Intronic
940369036 2:152879544-152879566 GTGTTTCCACATCTTTAAAATGG + Intergenic
940589444 2:155702510-155702532 ATTTTTGCACATTTTTAGTATGG + Intergenic
940698216 2:157007430-157007452 CTGTTTCCACATCTGTAAAATGG - Intergenic
941501810 2:166288445-166288467 CTTCTTGCTCTTTTTTAAGACGG + Exonic
941586919 2:167370919-167370941 TTGTTTGCTTGTTTTTAAGATGG - Intergenic
941609534 2:167644086-167644108 CAGTTTTCACAGTTTTAAGGAGG + Intergenic
941645612 2:168037390-168037412 ATGTTTCCAAATTTTTAAGAGGG + Intronic
942566746 2:177272135-177272157 CAGTTTGCTCATTTCTAAAATGG - Intronic
942814738 2:180038887-180038909 CTGTTTGAATATTTTTAATTTGG - Intergenic
943619532 2:190132953-190132975 CCTTTTGCACATTTTTAAATTGG - Intronic
943710050 2:191082884-191082906 ATGTGTTTACATTTTTAAGAGGG - Intronic
944017457 2:195059542-195059564 CTTTTTTCACATTGTAAAGATGG + Intergenic
944795649 2:203182130-203182152 TTGTTTGCACAATTTTGAGTTGG - Intronic
944978053 2:205080154-205080176 CTGTTTTTACATTTTTAAGGTGG + Intronic
945103437 2:206285466-206285488 TTATTTGCCCATTTTTAAGTTGG + Intronic
945201409 2:207285394-207285416 CAATTTGCTCATTTTTAAAATGG - Intergenic
945449504 2:209977517-209977539 CTGTTTCCTCATTTTTTACAGGG - Intronic
945828825 2:214758252-214758274 CTGTTTCCTCATTTATAAGATGG + Intronic
946887075 2:224232087-224232109 CTCTTTGCCCATTTTTTAAATGG + Intergenic
946895228 2:224317668-224317690 CAGTTTGCGAATTTTAAAGAGGG + Intergenic
947526121 2:230877762-230877784 CTGTTTCCTCATCTTTAAAATGG - Intronic
947925953 2:233922736-233922758 GTGTTTACATTTTTTTAAGAGGG - Intronic
948314833 2:237019747-237019769 CAGTTTGCACATCTTTAAAATGG - Intergenic
1168924363 20:1567035-1567057 CTGTTTGCATTTTTTAAATAAGG + Intronic
1168998952 20:2152832-2152854 CTGTTTTCTCATTTATAAAATGG + Intronic
1170532230 20:17305574-17305596 CTGTTTTCTCATCTTTAAAATGG + Intronic
1171162130 20:22936931-22936953 CTCATTGCACATATTTAAGATGG + Intergenic
1171216146 20:23353786-23353808 CAGTTTGCTCACTGTTAAGATGG - Intronic
1171235700 20:23522726-23522748 CTTCTTTCACATTTTTGAGATGG - Intergenic
1171350259 20:24496605-24496627 CTGTTTTCTCATCTTTAAAATGG + Intronic
1171402651 20:24887709-24887731 CTGTCTGCCCATTTTTAAATTGG - Intergenic
1171936968 20:31284223-31284245 CTGTTTGCCAGTTTTTAAAATGG - Intergenic
1171973739 20:31580678-31580700 CTGTTTCCTCATTTGTAAAATGG + Intergenic
1172024064 20:31935994-31936016 CTGTTTCCTCATTTGTAAAATGG + Intronic
1172063373 20:32202432-32202454 CTGTTTCCTCATTTATAAAATGG + Intronic
1172122074 20:32604320-32604342 CAGTTTGCTCATCTGTAAGATGG + Intronic
1172298335 20:33830004-33830026 CTGTTTCCTCATTTGTAAAATGG - Intronic
1172550157 20:35792880-35792902 CTGTTTGCCCAGCTATAAGATGG - Intronic
1172623663 20:36335400-36335422 CTGTTTGCTCATCTATAAAATGG + Intronic
1172946212 20:38691607-38691629 CTGTTTCCTCATTTGTAATATGG + Intergenic
1173169083 20:40708331-40708353 CAGTTTGCTCATCTATAAGATGG - Intergenic
1173299394 20:41787856-41787878 CTTTTTGCCCATTTTTAAATTGG + Intergenic
1173303444 20:41825554-41825576 CTTTTTGCCCATTTTTAAATTGG + Intergenic
1173934777 20:46851829-46851851 CTGTTTTCTCATCTTCAAGATGG - Intergenic
1174053456 20:47783051-47783073 CTGTTTCCTCATCTTTAATATGG + Intronic
1174423745 20:50417478-50417500 CAGTTTCCACATTTATAACATGG - Intergenic
1174917551 20:54669312-54669334 CTGTTTCCTCATTTTTAAAATGG + Intergenic
1174967596 20:55235408-55235430 TTCTTTGCTCATTTTTAATAGGG + Intergenic
1175001674 20:55635875-55635897 CTGTTTTCACATTTTGTACATGG - Intergenic
1175201546 20:57281254-57281276 CTGTTTTCTCATTTGTAAAATGG + Intergenic
1175652632 20:60739389-60739411 CAGTTTTCACTTTTTTAACAGGG + Intergenic
1175937704 20:62522120-62522142 CCTTTTGCCCATTTTTAATAGGG + Intergenic
1177216856 21:18141360-18141382 CTTTTTTCACATGTTTGAGAAGG - Intronic
1178230159 21:30773784-30773806 CAGTTTCCCCATTTGTAAGATGG - Intergenic
1179040173 21:37795873-37795895 CTGTTTCCTCATCTGTAAGATGG - Intronic
1179200162 21:39210459-39210481 CTGTTTGCACTCTTTAAAAAGGG - Intronic
1181544415 22:23593106-23593128 CTGTTTGAGCGTATTTAAGATGG - Intergenic
1181747177 22:24963542-24963564 CTGTCTGCACATTGTTCAGATGG + Intronic
1181927665 22:26373086-26373108 CTGTTTGCTCATCTGTAAAATGG + Intronic
1181956892 22:26593937-26593959 CTGTTTCCACATCTGTAAAATGG - Intronic
1182066796 22:27436770-27436792 CTGTGTGCGCATTTTGCAGATGG - Intergenic
1182241900 22:28922925-28922947 CGGTTTCCACATTTTAAAAAGGG - Intronic
1182551154 22:31101310-31101332 TAGTTTGCACTTTTTTCAGATGG - Intronic
1182882039 22:33742035-33742057 CAGTTTGCTCATATGTAAGATGG + Intronic
1182933997 22:34203103-34203125 CTCTTTGCTCATTTTTAATTGGG + Intergenic
1182944834 22:34312206-34312228 CTGTTTTCTCATTTGTAAAATGG - Intergenic
1182952633 22:34391601-34391623 CTGTTTGCACATTATCCATATGG + Intergenic
1183600639 22:38838303-38838325 CTATTTGCTCATCTGTAAGATGG + Intronic
1183770349 22:39919927-39919949 CAGTTTCCTCATCTTTAAGATGG - Intronic
1184507536 22:44913496-44913518 CTGTTTGCTCATCTGTAAGGTGG - Intronic
1184983321 22:48111750-48111772 CTGCTTGTAGAATTTTAAGATGG + Intergenic
949117369 3:343182-343204 CCCTTTGCATATATTTAAGAGGG - Intronic
949872611 3:8602125-8602147 CAGTTTCCACATCTATAAGATGG + Intergenic
949912053 3:8919447-8919469 CTGTTGGATCATTTTTATGATGG - Intronic
950116662 3:10455136-10455158 CAGTTTGCTCATCTGTAAGATGG + Intronic
950157122 3:10729959-10729981 CTGTTTCCTCATTTATAACACGG - Intergenic
950734855 3:14998584-14998606 CTCTTTGCTCATTTTTAAATTGG + Intronic
951397239 3:22184180-22184202 CTGTTCTCCCATTTGTAAGAAGG + Intronic
951511580 3:23508471-23508493 CAGTTTGCTAATTTTAAAGAAGG + Intronic
951920668 3:27851150-27851172 AAGTTTGCAGATATTTAAGAAGG + Intergenic
952308290 3:32164583-32164605 CTGTTTGCCCATCTGTAAAATGG - Intronic
952574087 3:34753684-34753706 CTGTGTGCACATTTGTTATATGG - Intergenic
952865082 3:37849850-37849872 CTGTTTCCTCATCTGTAAGATGG + Intergenic
953113041 3:39962152-39962174 CTGTTTGCCCATCTATAGGATGG + Intronic
953290672 3:41658262-41658284 TTGTTTGCACATTTAACAGATGG + Intronic
953411602 3:42693360-42693382 CTGTTTCCCCATGTTTAACAAGG - Intronic
954075277 3:48173932-48173954 CTGTTGAAGCATTTTTAAGATGG - Intronic
955029238 3:55200569-55200591 CTGTTTCCTCATTTGTAAAATGG + Intergenic
956099342 3:65750997-65751019 CTGTTTCCTCATCTTTAAAATGG + Intronic
956333577 3:68138669-68138691 CTGTTTCCTCATGTATAAGATGG + Intronic
956348104 3:68302961-68302983 CAGTTTTCTCATTTTTAAAATGG + Intronic
956357433 3:68409492-68409514 CTCCTGCCACATTTTTAAGAAGG + Intronic
958050716 3:88341493-88341515 CTGTTTCCTCATCTGTAAGATGG + Intergenic
958446338 3:94219816-94219838 CTATGTTCACATTTTTCAGATGG + Intergenic
958822416 3:98990777-98990799 CAGTTTCCTCATTTTTAAGATGG - Intergenic
959557844 3:107742828-107742850 CTGTTTGCAAATCTTTAGGATGG - Intronic
959700726 3:109296800-109296822 CTTTTTGCACATTTTTTAATTGG - Intronic
960015246 3:112880082-112880104 CTCTTTGCCCATTTTTAAACGGG + Intergenic
961656218 3:128443518-128443540 CAGTTTCCACATTTATAAAATGG - Intergenic
961797537 3:129420514-129420536 CTATTTCCACATTTGTAAAAGGG + Intronic
961921601 3:130432249-130432271 CAGTTTCCTCATTTTTAACATGG - Intronic
962573997 3:136738966-136738988 CGATTTTCTCATTTTTAAGATGG - Intronic
962775441 3:138654918-138654940 CAGTTTACACAATTTTAAAAGGG + Exonic
963394153 3:144710569-144710591 CTTTTGGCATATTTTTAAAAGGG - Intergenic
963541140 3:146590193-146590215 CTTCTTTTACATTTTTAAGATGG - Intronic
963792499 3:149598374-149598396 CAGTTTCCTCATTTATAAGATGG - Intronic
964524124 3:157599054-157599076 GTGTCTGCACATTTTTTAGTAGG + Intronic
964564090 3:158030637-158030659 CTGTTTCCTCAGTTTTAAAATGG + Intergenic
965368503 3:167829716-167829738 CAGTTTATACATTTTTAAAATGG - Intergenic
965509118 3:169548875-169548897 CAGTTACCACATTTGTAAGAAGG - Intronic
965546093 3:169917940-169917962 CTGTTTGTTTATTTTTGAGATGG + Intronic
965650879 3:170931616-170931638 CTGTTTGCCCATTTTTTAATTGG - Intergenic
965988867 3:174791188-174791210 CTGTTTGCCCACATATAAGAGGG - Intronic
966447515 3:180019483-180019505 CTGTTTGCACATTTAAAATGAGG - Intronic
966651468 3:182305557-182305579 CTGTTTCCTCATTTATAAGCAGG + Intergenic
967189320 3:186972119-186972141 CTGTTTCCTCATTTATAAAATGG - Intronic
967311861 3:188113762-188113784 CTGTTGCCCCATTTTTAAGATGG - Intergenic
967442381 3:189524084-189524106 TTGTTTGCCCATTTTTTAAACGG - Intergenic
967577976 3:191119666-191119688 CAGTTTTCTCATTTTTAAAATGG + Intergenic
967911655 3:194547239-194547261 CTTTTTGCCCATTTTTAAATTGG + Intergenic
969048701 4:4357129-4357151 CTGTGTGCACATCTGTAAAATGG + Intronic
969156337 4:5213730-5213752 CTGTTTGCTCCTTTTTAAGAAGG + Intronic
969318540 4:6396380-6396402 CTGTTTGCTCATCTTTATAATGG - Intronic
969798811 4:9546551-9546573 GTGTTTACACTTTTTTAAAAAGG + Intergenic
970230266 4:13902688-13902710 CTATTAGCCCATATTTAAGATGG + Intergenic
970254719 4:14155389-14155411 CAGTTTTCTCATTTGTAAGATGG + Intergenic
970355475 4:15246780-15246802 CTATTTCCACATTCTTCAGAAGG + Intergenic
971027782 4:22605677-22605699 CTGTTTTCTCATTTTTAAAGTGG + Intergenic
971040228 4:22743634-22743656 CTGTTTTCTCATTTTTAAATGGG + Intergenic
971778885 4:31004803-31004825 CTGTTTTCTCATCTTTAAAAAGG - Intronic
972449387 4:39181645-39181667 ATGTTTGCAAATTCTTAAGTAGG - Intergenic
972952051 4:44339097-44339119 CTTTTTGCAGTTTTTAAAGAAGG - Intronic
973705279 4:53574723-53574745 CTGTTTTCACATCTGTAAAATGG + Intronic
973811578 4:54575558-54575580 CTGTTTCCTCATCTTTAAAATGG - Intergenic
973838321 4:54834313-54834335 CTTTTTGCTTGTTTTTAAGATGG - Intergenic
973946923 4:55966822-55966844 GTCCTTGCACATTTTTAAGTTGG + Intronic
974373996 4:61053191-61053213 CTGTTTGCAAATTGATGAGAGGG + Intergenic
974486370 4:62510873-62510895 CTCTAGGAACATTTTTAAGAAGG + Intergenic
974757036 4:66223146-66223168 CTGTAAGCACATTTTCGAGAGGG - Intergenic
974974776 4:68877107-68877129 CTGTCTTGCCATTTTTAAGAAGG + Intergenic
975286037 4:72621552-72621574 CTGTTTGTCAATTTTTAGGAAGG + Intergenic
975437488 4:74370013-74370035 CTGTTTCCTCATTTGTAAAACGG - Intronic
975674580 4:76813274-76813296 CTGTTTGCTCATCTGTAAAATGG + Intergenic
976353971 4:84093420-84093442 CAGTTTTGACATTTCTAAGAGGG - Intergenic
976911369 4:90310638-90310660 CTGTTTTCACATTTGTAAAATGG - Intronic
976958505 4:90935619-90935641 ATTTTTGCATATTTTTAAGTTGG - Intronic
977520747 4:98080750-98080772 CTGGTTGCATGTTTTGAAGATGG - Intronic
977560671 4:98530390-98530412 CTGTTTCCTCATTTGTATGATGG - Intronic
977629507 4:99226135-99226157 TTCTTTGCCCATTTTTAAGTTGG + Intergenic
977848055 4:101790169-101790191 TTGTTTGCTTGTTTTTAAGATGG - Intronic
978028011 4:103901897-103901919 TTGTTTGCCCATTTTTTTGATGG - Intergenic
978130624 4:105192068-105192090 CTGAGAGCGCATTTTTAAGATGG + Intronic
978234005 4:106435683-106435705 GTTTTTACACATTTTTAATAGGG + Intergenic
979406957 4:120324806-120324828 CAGTTTGCACGTTTGTAAAATGG + Intergenic
979587000 4:122432258-122432280 AAGTTTTGACATTTTTAAGATGG + Intergenic
979722462 4:123917428-123917450 CTGTTTCCTCATTTATAAAATGG - Intergenic
980255681 4:130378011-130378033 TTTTTTGCCCATTTTTAAAATGG + Intergenic
980514551 4:133838000-133838022 CTTTCTGCCCATTTTTAAGTTGG + Intergenic
980862012 4:138510252-138510274 CTGTTTTGCCATTTTTAGGACGG - Intergenic
981806711 4:148724527-148724549 GTGTTGGCAAATTTTTAAAAAGG - Intergenic
983505883 4:168553091-168553113 CAGTTTTCACATCTTTAAAATGG - Intronic
983570685 4:169204930-169204952 CTGCTTGCTGATTTTTAAAAAGG + Intronic
984068318 4:175078695-175078717 ATGTTTGCCCATTTTTAAATAGG + Intergenic
984655471 4:182312713-182312735 CTATTTACACATTTCTATGATGG - Intronic
985228340 4:187787143-187787165 CAGTTTGCACATCCTTAAAATGG + Intergenic
985274990 4:188229551-188229573 CAGTTTTCTCATTTTTAAAATGG + Intergenic
985656633 5:1135156-1135178 CGGTTTGCTCATCTGTAAGATGG + Intergenic
985969975 5:3367543-3367565 TATTTTGCACATTTTTAATAGGG + Intergenic
986444391 5:7808524-7808546 CTCTTTGCCCATTTTAAAGATGG + Intronic
986776891 5:11023943-11023965 CTGTTCTCACATTTTTCAGATGG + Intronic
986973718 5:13370411-13370433 TTCTTTGCTCATTTTTAATAAGG - Intergenic
987078602 5:14406306-14406328 CTGTTTTCTCATTTTTAAAATGG + Intronic
987255540 5:16146693-16146715 TTGTTTCCAAATTTTTAAGTCGG + Intronic
987525312 5:19042004-19042026 CTGTTTGTAGATTGTTTAGATGG + Intergenic
987641642 5:20619673-20619695 CTGTTTGCAAATTTGTAAATAGG + Intergenic
987850300 5:23344015-23344037 TTCTTTGCACATTTTTTAGTTGG - Intergenic
988079277 5:26395794-26395816 CTGTTTGGTCATTTTTAAAAGGG - Intergenic
988469387 5:31524308-31524330 CTGTTTCCACATTTTTCTCATGG - Intronic
988564066 5:32306753-32306775 CAGTTTGCACATCTGTATGATGG + Intronic
988945606 5:36194365-36194387 ATGTTTGAGCATTTTAAAGATGG + Exonic
989545923 5:42673079-42673101 CTGCTTGCCCATTTTTAAATGGG - Intronic
989796716 5:45483441-45483463 TAGTTTGCCCATTTTTAAAATGG + Intronic
990079324 5:51893104-51893126 CAGTTTCCACATTTTTAAAAAGG - Intergenic
990248714 5:53891107-53891129 AAGTTTGCAGATTTTTAAAAAGG - Intronic
990499578 5:56382179-56382201 CTGTAGGGACATTTTTAAGAAGG + Intergenic
990724954 5:58743153-58743175 TTCTTTTCTCATTTTTAAGATGG - Intronic
990890190 5:60640362-60640384 TTTTTTGCATATTTTTAAGAAGG - Intronic
990950668 5:61295199-61295221 CAGTTTCCTCATTTTTAAAATGG + Intergenic
991015072 5:61923248-61923270 CTGATTGCAAATTTTTAATCAGG - Intergenic
991319021 5:65347807-65347829 TTCTTTGTACATTTTTAATAGGG - Intronic
992130655 5:73689244-73689266 CTGTTTGCTCATTTTTAGGAAGG + Intronic
992739249 5:79756504-79756526 TTGTTTTCTCATTTTAAAGATGG + Intronic
993335428 5:86652260-86652282 CTGTATACACATGTTTATGACGG + Intergenic
993483760 5:88456180-88456202 CTGTTTGCACAGTTGTTAAATGG + Intergenic
993693020 5:91026046-91026068 CAGTTTTCTCATTTTTAAAATGG - Intronic
993867330 5:93211041-93211063 CTGGTTACACATCTTAAAGAAGG - Intergenic
994199984 5:96962522-96962544 CAGTTTGCTCATTTATAAGATGG - Intronic
994722110 5:103392306-103392328 CTGTTTCTTCATCTTTAAGATGG + Intergenic
994754426 5:103777516-103777538 CAGTTTGCTCATCTGTAAGACGG - Intergenic
995865382 5:116684716-116684738 CTGTTTTCACATCTATAAGGTGG - Intergenic
996034477 5:118742644-118742666 CTTTGTGCACATTTTTAAATAGG + Intergenic
996083857 5:119284126-119284148 CTGTTTTCCCATCTTTAAAATGG - Intronic
996356750 5:122604078-122604100 ATGATTGCACATTTTCAAGAGGG - Intergenic
996659042 5:125977726-125977748 CTGTGTGCTCATTTTTCAAAAGG - Intergenic
996763751 5:127014216-127014238 CTGTTGGCTCATTTTTAAATTGG - Intronic
997180041 5:131819082-131819104 CTGTTTTCTCATTTATAAAATGG - Intronic
997391093 5:133517119-133517141 CAGTTTGTACATTTTTTAGTCGG - Intronic
997991137 5:138545148-138545170 CTGTGTCCACACTTTGAAGATGG + Intergenic
998096444 5:139398197-139398219 CTGTTTCCTCATTTCAAAGATGG + Intronic
998313717 5:141159719-141159741 TTATTTGCTCATTTTTAAGCAGG - Intergenic
998581575 5:143382569-143382591 CTGTTTCCTCACTTTTAAAATGG - Intronic
998740579 5:145196201-145196223 CTGTTTGCAGGGCTTTAAGAAGG - Intergenic
998806754 5:145924706-145924728 CTGTTTCCTCATCTGTAAGATGG + Intergenic
998939516 5:147265971-147265993 CACTTTACCCATTTTTAAGAAGG - Intronic
999386931 5:151160444-151160466 CTTTTTGCTCATTTTTAAATTGG + Intergenic
1000787835 5:165568551-165568573 CTTTTTGCCCATTTTTATGATGG + Intergenic
1001051407 5:168417485-168417507 CAGTTTCCTCATTTTTAAAATGG - Intronic
1001812650 5:174641243-174641265 CAGTTTACTCATTTGTAAGATGG - Intergenic
1001895252 5:175373704-175373726 CTATGTCCATATTTTTAAGAAGG + Intergenic
1001901897 5:175438321-175438343 CTGTTTGCCCATTTGTGAAATGG - Intergenic
1001956646 5:175852301-175852323 CCGTTTGCTCATTGTTAAAATGG - Intronic
1002047834 5:176552018-176552040 CTGTTTGCTCCTTTTAAAAATGG - Intronic
1002203069 5:177542318-177542340 CTGTTTGCTCATCTGTAAAATGG + Intronic
1002559141 5:180069676-180069698 CTGTTTGCTCATCTGTAAAATGG - Intronic
1003268823 6:4589707-4589729 ATGTGTGCATATTTTTAGGAAGG - Intergenic
1003367842 6:5493647-5493669 CTGTTTCCTCATTTATAAAATGG + Intronic
1003376086 6:5578929-5578951 CTGTTTTCTCATTTGTAAAATGG + Intronic
1004180138 6:13374122-13374144 CAGTTTCCACATCTGTAAGATGG - Intronic
1005227243 6:23656896-23656918 CAGAATCCACATTTTTAAGAGGG - Intergenic
1005583426 6:27253731-27253753 CTGTTTCCACATCTATAAAATGG + Intronic
1005946591 6:30600369-30600391 GTGTTTGGACTTTTTTGAGACGG - Intergenic
1006756065 6:36416609-36416631 CAGTTTCCCCATTTTTAAAAAGG + Intronic
1007020989 6:38521251-38521273 CTATTTCCACATTTTGTAGATGG - Intronic
1007286701 6:40753056-40753078 CAATTTGCACATCTTTAAAATGG + Intergenic
1009195862 6:60683656-60683678 CTGTTTCCTCATATTTAAAATGG + Intergenic
1009420881 6:63463157-63463179 CTGTTTTCCCATCTTTCAGAGGG + Intergenic
1009514009 6:64590954-64590976 CTTTTTGCACTCTTTTTAGAAGG + Exonic
1009569590 6:65366935-65366957 CTGTATGCAACTTTTTAATAAGG + Intronic
1010217708 6:73419401-73419423 TTGTTTGTTCATTTTTGAGACGG - Intronic
1010668740 6:78660743-78660765 CTGTTTGCAAATCTTAAAAATGG + Intergenic
1011554429 6:88559861-88559883 CTGTTTGCACAGCATTAATAAGG + Intergenic
1011862427 6:91776408-91776430 TTCTTTGCCCATTTTTAATAGGG - Intergenic
1012793249 6:103727264-103727286 CCGTTTGCCCATTTTTAATTTGG + Intergenic
1012876279 6:104731884-104731906 TTGTTTGCCCATTTTTAATCGGG - Intronic
1012962879 6:105641184-105641206 TTATATACACATTTTTAAGATGG + Intergenic
1013289767 6:108709863-108709885 CAGTTTCCACATTTGTAAAATGG - Intergenic
1013342239 6:109226113-109226135 CTGTTTCCACATTTGTACAATGG - Intergenic
1015514136 6:134068032-134068054 CTCTTCACACATTTTAAAGATGG + Intergenic
1015529076 6:134202910-134202932 TTGTTTGCAAATTTTGACGATGG + Intronic
1015703060 6:136057032-136057054 CGGTTTTCTCATTTGTAAGATGG + Intronic
1016529049 6:145038012-145038034 TTGTTTGCTTGTTTTTAAGATGG - Intergenic
1016716853 6:147243403-147243425 TTTTTTGCCCATTTTTAAGTTGG + Intronic
1016946423 6:149538814-149538836 TTGTTTGCTCATCCTTAAGAAGG - Intronic
1017185260 6:151594307-151594329 CTGTTTCCTCATATTTAAGATGG + Intronic
1017308603 6:152950297-152950319 TAGGTTGCACATTTTAAAGAGGG + Intergenic
1017393336 6:153966363-153966385 CTGTGTGCACATATTTTACAAGG + Intergenic
1017471549 6:154741706-154741728 CCGTTTGCATCTTTTTCAGAAGG + Intronic
1018145199 6:160879490-160879512 TGATTTGCACATTTTTAATAGGG - Intergenic
1018439401 6:163795564-163795586 TTGTCTGCATATTTTTAAGATGG + Intergenic
1018728141 6:166628931-166628953 CTTTTTGCTCCTTTTCAAGATGG + Intronic
1019377223 7:699237-699259 CCGTTTTCTCATTTGTAAGATGG + Intronic
1020331430 7:7020995-7021017 TTGTTTTTACTTTTTTAAGATGG - Intergenic
1020352744 7:7239547-7239569 CAGTTTCCTCATTTGTAAGATGG + Intronic
1020529297 7:9310630-9310652 TTGTTTTTACATTTTTATGAAGG + Intergenic
1020808883 7:12826863-12826885 CTTTTTGCACATCTTCCAGAGGG + Intergenic
1021071335 7:16245248-16245270 CAGTTTGCTCATTAGTAAGAGGG - Intronic
1021337838 7:19425631-19425653 CTGTTTTCACATCTCTAAAATGG + Intergenic
1021393827 7:20124170-20124192 CTTTTTGCACTTTGTTAGGATGG - Intergenic
1021410674 7:20327000-20327022 CAGTTTCCACATTTGTAAAATGG + Intergenic
1021618425 7:22526395-22526417 CTTTTTGCCCATTTTTAATGAGG - Intronic
1021927486 7:25547382-25547404 CTGTTTGCTCTTTGTGAAGATGG + Intergenic
1022119784 7:27297084-27297106 GTGTTTGCACATTCTGAAGTTGG + Intergenic
1022150013 7:27592922-27592944 CTGGTGGCACATTTTAAACAGGG - Intronic
1022591112 7:31664012-31664034 CTGTTTCCTCATCTTTAAAATGG - Intergenic
1022712250 7:32862919-32862941 GTGTTTCCACATCTATAAGATGG - Intergenic
1022881687 7:34594631-34594653 CTGTTTTCACATTTGTAAAATGG + Intergenic
1022911627 7:34904446-34904468 GTGTTTCCACATCTATAAGACGG + Intergenic
1022928020 7:35075866-35075888 CTTTTTGCCCATTTTTAATGAGG - Intergenic
1023388833 7:39687787-39687809 CTGTTTTCACATCTGTAAAATGG - Intronic
1023722318 7:43109694-43109716 ATTTTTGCTCATTTTTAAGTGGG - Intergenic
1024162592 7:46692565-46692587 CTGTTTGCACATATTTCAGCTGG - Intronic
1024177446 7:46855596-46855618 CTTTTTACACTTTTTAAAGACGG + Intergenic
1024517500 7:50271825-50271847 CTTTTATCACATTTTTAAGGTGG + Intergenic
1025818962 7:64945727-64945749 CTGTTTCCTTATCTTTAAGATGG - Intergenic
1026352794 7:69532323-69532345 CAGTTTTCTCATTTTTAAAATGG - Intergenic
1027225214 7:76239374-76239396 CTGTTTGCTCATCTATAAAATGG + Intronic
1027404782 7:77848530-77848552 CCTTTTGCCCATTTTTAAAATGG + Intronic
1027631211 7:80608604-80608626 CTGTTTACTCATTTGTAAAATGG - Intronic
1027957199 7:84895793-84895815 TTCTTTGCCCATTTTTAATAGGG + Intergenic
1028374259 7:90129726-90129748 CTTTTTGCCCATTTTTAATGAGG + Intergenic
1028481609 7:91312579-91312601 CTGTTTTCTCATTTTTATAATGG - Intergenic
1029269565 7:99369038-99369060 TTATTAGCACATTTTTCAGATGG + Intronic
1029361652 7:100092586-100092608 CTGTTTGGAGATACTTAAGATGG - Intergenic
1030232072 7:107219011-107219033 TTTTTTGCACATTTTTAAATTGG - Intronic
1030609781 7:111676661-111676683 ATGTTTGTACATTTAGAAGATGG + Intergenic
1030750967 7:113232315-113232337 CTGTTTCCACATATGTAATATGG - Intergenic
1030847974 7:114445671-114445693 TTGTTTTCACATTATTAAAATGG - Intronic
1031148466 7:118025007-118025029 CTTTTTGCACATATTTAATTTGG - Intergenic
1031390626 7:121209930-121209952 TTGTTTGCCCATTTTTAAATTGG - Intronic
1031405933 7:121387213-121387235 TGGTTTTCACATTTTTAAGTGGG - Intronic
1031624238 7:123973940-123973962 CTGTTTTCTCATTTTTAATATGG + Intergenic
1031747373 7:125518234-125518256 TTGGTTCCACATTTTTGAGAGGG + Intergenic
1032127339 7:129204714-129204736 CAGTTTCCCCATTTCTAAGATGG - Intronic
1032658672 7:133959142-133959164 CTGTCTGCTCATATTTAAGTGGG - Intronic
1032848029 7:135768458-135768480 CAGTTTGCCCACTTTGAAGAAGG - Intergenic
1032876344 7:136042255-136042277 CTGTTTTCTCATTTATAAGATGG - Intergenic
1034137265 7:148782426-148782448 GTGTTTTAACATTTTTAAGATGG + Intronic
1034968708 7:155406659-155406681 CGGTTTCCACATTTTTGAAAGGG - Intergenic
1035006921 7:155670606-155670628 CTGTTTTCACATTTTGAAAATGG + Intronic
1035057741 7:156047292-156047314 CTCTTTGCCCATTTTTAAACCGG - Intergenic
1035062809 7:156081692-156081714 TTGTTTGCTTATTTTTAAGGAGG + Intergenic
1036447250 8:8832388-8832410 ATTTTTGCCCATTTTTAATAGGG - Intronic
1036889182 8:12584446-12584468 CTGTTTGCAGAGTCTTAAAATGG - Intergenic
1036945334 8:13089708-13089730 CTGTTTGTTTATTTTCAAGATGG + Intronic
1037185095 8:16053963-16053985 CTGAATGAACCTTTTTAAGAAGG + Intergenic
1037233227 8:16685629-16685651 TTTTTGGCAAATTTTTAAGAGGG - Intergenic
1037513513 8:19607218-19607240 CTGTTTTCACATTGTCAACATGG + Intronic
1038321716 8:26533196-26533218 TTCTTTGCCCATTTTTAAGTTGG + Intronic
1038537834 8:28366975-28366997 CTGTTACCCTATTTTTAAGAGGG + Intronic
1038594268 8:28871912-28871934 CTTTTTGCACATTTTTCTGTTGG - Intronic
1039321586 8:36437895-36437917 CTGTTTGTACATTTAGAAAAAGG - Intergenic
1039325839 8:36484602-36484624 CGGTTTGCTCATTTGTAAAATGG + Intergenic
1040575476 8:48647718-48647740 CGGTTTCCACATTTCTAAAATGG + Intergenic
1040972668 8:53153965-53153987 CTGTTTTCTAATTTTTAAAAAGG + Intergenic
1041272865 8:56125722-56125744 CTATTTTCAAATTTTTGAGATGG + Intergenic
1042243138 8:66684751-66684773 CTTATTGCACATTAATAAGAAGG + Intronic
1042448638 8:68919493-68919515 CTGTTGGTGCACTTTTAAGATGG + Intergenic
1042539446 8:69893509-69893531 CAGTTTTTACATTTTTAAGGAGG - Intergenic
1042681004 8:71384244-71384266 CCATTTAAACATTTTTAAGAAGG + Intergenic
1042917661 8:73891190-73891212 CTGTTTCCTTATTTGTAAGAAGG - Intergenic
1042941214 8:74110353-74110375 CTGTTTCCCCATTTATAAAATGG - Intergenic
1043874148 8:85465091-85465113 CAGTTTCCACATTTGTAATATGG - Intronic
1043911365 8:85868194-85868216 CAGTTTTCACATGTTTAAAATGG - Intergenic
1044636820 8:94333713-94333735 CAGTTTTCTCATTTTTAAAATGG - Intergenic
1044648800 8:94473442-94473464 CAGTTTCCTCATCTTTAAGAGGG + Intronic
1044682464 8:94795746-94795768 CTCTTTGCCCATTTTTAAGTTGG + Intergenic
1045061528 8:98415466-98415488 ATGTTTGAAGAATTTTAAGAAGG - Intronic
1045128134 8:99117164-99117186 CTCTTTGCCCATTTTTAATTGGG - Intronic
1045220950 8:100199746-100199768 CTCTTTGCCCATTTTTAATTGGG + Intronic
1045303983 8:100940750-100940772 CTGTTTCCACATCTTCAAAATGG - Intronic
1045517706 8:102875044-102875066 CTGTTTTCTCATTTGTAAAATGG - Intronic
1045921527 8:107535795-107535817 CAGTTTGCAAATTTAAAAGAGGG - Intergenic
1046171044 8:110506557-110506579 GTGTTTTCACATTTTTAATGTGG + Intergenic
1046760218 8:118012658-118012680 CAGTTTCCACATCTTTAAAATGG + Intronic
1047002683 8:120588676-120588698 CTGTTTCCACATCTGTAAAATGG + Intronic
1047215865 8:122875689-122875711 CTGTTTCCACATGTGTAAAAGGG - Intronic
1047364362 8:124198666-124198688 CTGTTTCCTCATTTATTAGATGG - Intergenic
1047483467 8:125306847-125306869 TTGTTTCCACATCTGTAAGATGG + Intronic
1047620260 8:126599306-126599328 CTGTTTGCCCATTTTCAAATTGG + Intergenic
1047769832 8:128021703-128021725 CTTTTTGCACTATTTTAAGATGG - Intergenic
1047950354 8:129928458-129928480 CTTTTTGCCCATTTTTAATTGGG - Intronic
1048374389 8:133810166-133810188 CTGTTTTCTCATTTCTAAGTTGG + Intergenic
1048610338 8:136015318-136015340 CTTTTTGGACATTTCTCAGAAGG + Intergenic
1049001306 8:139827097-139827119 CTGTTTGCCCATTTCTAAAATGG + Intronic
1050027705 9:1352834-1352856 CATTTTGTACATTTTAAAGATGG - Intergenic
1052100636 9:24441851-24441873 CCCTTTGCTCATTTTTAATAGGG + Intergenic
1052281663 9:26740286-26740308 TTGTTTGCGCATTTTTAATAAGG - Intergenic
1052465748 9:28827461-28827483 CAGTTTCCACATCTTTAAAATGG + Intergenic
1052554701 9:29999051-29999073 TTTTTTGCCAATTTTTAAGAAGG - Intergenic
1053687539 9:40551850-40551872 CTGTTTGCACAATCTGAAGGTGG + Intergenic
1053939354 9:43215352-43215374 CTGTTTGCACAATCTGAAGGTGG + Intergenic
1054276212 9:63074654-63074676 CTGTTTGCACAATCTGAAGGTGG - Intergenic
1054398620 9:64690277-64690299 CTGTTTGCACAATCTGAAGGTGG + Intergenic
1055006548 9:71513873-71513895 CAGTTTGCTCATCTGTAAGATGG - Intergenic
1055245536 9:74237955-74237977 TTGTTTGCCCATTTTTAAATTGG - Intergenic
1055397016 9:75886920-75886942 CAGTTTGCAGAGTTTCAAGATGG + Intergenic
1055729948 9:79270235-79270257 CTGTTTACTCATCTTTAAAATGG - Intergenic
1055756433 9:79563391-79563413 CAGTTTTCAAATTTTTAAGATGG + Intergenic
1057233755 9:93342395-93342417 CTGTTTGCACATGCTTAAAATGG - Intronic
1057252089 9:93511628-93511650 CTGTTTGCACATGCTTAAAATGG + Intronic
1057362292 9:94384639-94384661 CTCTTTGCCCATTTTTAAATTGG + Intronic
1057661051 9:97003464-97003486 CTCTTTGCCCATTTTTAAATTGG - Intronic
1057745074 9:97745000-97745022 CTGTTTGAACATATGTAGGATGG - Intergenic
1057940213 9:99275480-99275502 CTATTTGCATATTGTTATGAGGG - Intergenic
1058000230 9:99857451-99857473 CTGTTTCCACATTTGTAAAATGG - Intronic
1058052918 9:100424680-100424702 CAGTTTTCTCATTTCTAAGATGG - Intergenic
1058723650 9:107781969-107781991 CAGTTTTCACATCTATAAGATGG - Intergenic
1059622913 9:116028262-116028284 CTGTTTGCACCTTTTAAAAATGG - Intergenic
1060196123 9:121624447-121624469 CAGTTTGCTCATCTGTAAGATGG + Intronic
1060214618 9:121731293-121731315 CTGTTTTCACATCTGTAAAATGG + Intronic
1060490480 9:124080538-124080560 CTGTTTCCACATCATTAAAATGG + Intergenic
1060912143 9:127359520-127359542 CTGCTTACACAGTTTTGAGAAGG - Intronic
1060917549 9:127400051-127400073 CTGTTTACACATCTGTAAAATGG - Intronic
1061101925 9:128498647-128498669 CTGTGTGCCCATTTTTCAGATGG - Intronic
1062061142 9:134495806-134495828 CTGATTGCATATTTTAAAGTGGG - Intergenic
1186155969 X:6727188-6727210 CCTCTTGAACATTTTTAAGAGGG - Intergenic
1186337299 X:8604069-8604091 TTGTTTCCCCATTTTTAAAATGG - Intronic
1186623138 X:11262850-11262872 CGGTTTTCTCATTATTAAGATGG + Intronic
1186879129 X:13847161-13847183 ATGTTTGCACACATATAAGATGG - Intronic
1187078563 X:15961809-15961831 CTGTTTGCTAATTTATAAAATGG - Intergenic
1187383373 X:18825422-18825444 CTGTTTTCAAATTTGTAAAATGG + Intronic
1187459536 X:19474382-19474404 CAGTTTTCTCATCTTTAAGAGGG + Intronic
1187578831 X:20586926-20586948 CTGTTTTCACATTTTTCTGCTGG - Intergenic
1187768295 X:22667525-22667547 ATTTTTGGGCATTTTTAAGATGG + Intergenic
1187778105 X:22786776-22786798 TTTTTTGCCCATTTTTAAAATGG - Intergenic
1188248497 X:27862677-27862699 TTATTTGCTCATTTTTAAGTGGG - Intergenic
1188279307 X:28244765-28244787 CTGGTTGAACATTTTAAAAATGG - Intergenic
1188691565 X:33135744-33135766 CAATTTTCACATTTTTAAAATGG + Intronic
1188825421 X:34826990-34827012 AAGTTTGCACATTTTTAACTGGG - Intergenic
1188836978 X:34970142-34970164 CCATTTCCACATTTATAAGAAGG - Intergenic
1189066127 X:37810997-37811019 CTTTTTGTCCATTTTTAAGCAGG - Exonic
1189193867 X:39135252-39135274 CAGTTTCCACATCTTTAAAATGG - Intergenic
1189198742 X:39173888-39173910 CAGTTTGCACATCTATAAAATGG - Intergenic
1189270092 X:39745249-39745271 CTGTTTCCTCATCTTTAAAATGG - Intergenic
1189501309 X:41562011-41562033 CAGTTTTCACATTTGTAAAATGG + Intronic
1189691564 X:43622859-43622881 CTTTGTGCACATTTATATGAAGG - Intergenic
1189876096 X:45437762-45437784 CTGTTTCCTCATTTGTAAAATGG - Intergenic
1189966222 X:46376596-46376618 CTGTCTCCTCATCTTTAAGATGG - Intergenic
1190116829 X:47630625-47630647 CTGTGAGCACATTTTACAGAGGG - Intergenic
1190428833 X:50358336-50358358 CTGTTTGCACATTTTTAATTGGG + Intergenic
1190462721 X:50694520-50694542 GTCTTTGCCCATTTTTAAGTTGG + Intronic
1190498233 X:51048324-51048346 CTGTTTGCTCATGTTTCTGATGG - Intergenic
1190508113 X:51148829-51148851 CTGTTTGCTCATGTTTCTGATGG + Intergenic
1191585996 X:62827341-62827363 TTGTTTCCACATTTTAGAGATGG - Intergenic
1191999269 X:67130823-67130845 CAGTTTGCTCATTTGTAAAATGG + Intergenic
1192175333 X:68881406-68881428 CTGCGTGCACATTTGGAAGAAGG + Intergenic
1192244592 X:69362028-69362050 CAGTTTGCTCATCTATAAGATGG + Intergenic
1193108891 X:77707441-77707463 CCCTTTGCCCATTTTTAAAATGG - Intronic
1193431029 X:81405909-81405931 CTGTGTGCAAATTTTGAAGAAGG - Intergenic
1193558853 X:82992384-82992406 TTGTTTGCACACTTTTAAATAGG + Intergenic
1193954082 X:87836968-87836990 CTCTTTAAACATATTTAAGATGG + Intergenic
1194988168 X:100513884-100513906 CCTTTTGCTCATTTTTAAAATGG - Intergenic
1195522002 X:105841911-105841933 CTGTTTGCTCGTTTGTGAGATGG - Intronic
1195744124 X:108097136-108097158 CTGTTTTCTCATTTTAAAAAAGG - Intronic
1195787007 X:108536826-108536848 CTGTTTTCTCATTTGTAAAATGG - Intronic
1195935434 X:110120998-110121020 CAGTTTCCACATTTTTCAAATGG + Intronic
1196264311 X:113623959-113623981 TTTTTTGCAAATTTTTAAGTTGG + Intergenic
1196486136 X:116210099-116210121 TTCTTTGCCCATTTTTAATAAGG - Intergenic
1197721766 X:129750197-129750219 CATTTTGCACATTTGTAAAATGG - Intronic
1197742014 X:129902499-129902521 CTGTTTTCTCATCTTTAAAATGG - Intergenic
1198047232 X:132914886-132914908 ATGTTTGATCATTTTTAAGCTGG - Intronic
1198100979 X:133421522-133421544 CAGTTTGCTCTTTTTTATGAAGG + Intergenic
1198284188 X:135173599-135173621 ATCTATGTACATTTTTAAGATGG - Intergenic
1198286565 X:135197094-135197116 ATCTATGTACATTTTTAAGATGG - Intergenic
1198494167 X:137173964-137173986 CTGTTTTCATATCTTTAAAATGG - Intergenic
1198582904 X:138086589-138086611 TTGTTTGCCCATTTTTAAGCTGG - Intergenic
1199029996 X:142986504-142986526 CAGTTTCCACATTTATAAAAGGG - Intergenic
1199304907 X:146256106-146256128 ATGTTTTCACTGTTTTAAGATGG - Intergenic
1199351009 X:146800089-146800111 CTTATTGAACATTTTTAATAAGG + Intergenic
1199363529 X:146950368-146950390 CTATTTCCACTTATTTAAGATGG + Intergenic
1199427612 X:147721265-147721287 CTGTTTCCACATCTCTAATATGG - Intergenic
1199776558 X:151016857-151016879 CAGTTTCCACATTTATAAAATGG + Intergenic